Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628669362:

Variant ID: vg0628669362 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 28669362
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCGGATGTCCCCTCCCTAAATAGGCATCATTACCCATAACAAATTCACACAACACGGGTCGTGCCATAGACACGAAACGCTAGCCACCACGCCAAGCGCC[C/T]
AACCCCAACTCCAACTCCAACCCGTCGTGCTCACCGAGAAAGGCGAAATTGAAAACCACCCCAACCCGAGAAAATTGCATATCTACCATCGCATAAGATT

Reverse complement sequence

AATCTTATGCGATGGTAGATATGCAATTTTCTCGGGTTGGGGTGGTTTTCAATTTCGCCTTTCTCGGTGAGCACGACGGGTTGGAGTTGGAGTTGGGGTT[G/A]
GGCGCTTGGCGTGGTGGCTAGCGTTTCGTGTCTATGGCACGACCCGTGTTGTGTGAATTTGTTATGGGTAATGATGCCTATTTAGGGAGGGGACATCCGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.00%	40.00%	0.06%	0.00%	NA
All Indica	2759	87.00%	13.00%	0.04%	0.00%	NA
All Japonica	1512	3.00%	97.00%	0.00%	0.00%	NA
Aus	269	90.30%	9.70%	0.00%	0.00%	NA
Indica I	595	72.60%	27.40%	0.00%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	90.90%	9.10%	0.00%	0.00%	NA
Indica Intermediate	786	86.60%	13.20%	0.13%	0.00%	NA
Temperate Japonica	767	3.00%	97.00%	0.00%	0.00%	NA
Tropical Japonica	504	2.60%	97.40%	0.00%	0.00%	NA
Japonica Intermediate	241	4.10%	95.90%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	61.10%	36.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0628669362	C -> T	LOC_Os06g47294.1	upstream_gene_variant ; 1507.0bp to feature; MODIFIER	silent_mutation	Average:62.46; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N
vg0628669362	C -> T	LOC_Os06g47300.1	upstream_gene_variant ; 836.0bp to feature; MODIFIER	silent_mutation	Average:62.46; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N
vg0628669362	C -> T	LOC_Os06g47300.2	upstream_gene_variant ; 842.0bp to feature; MODIFIER	silent_mutation	Average:62.46; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N
vg0628669362	C -> T	LOC_Os06g47300.3	upstream_gene_variant ; 842.0bp to feature; MODIFIER	silent_mutation	Average:62.46; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N
vg0628669362	C -> T	LOC_Os06g47294-LOC_Os06g47300	intergenic_region ; MODIFIER	silent_mutation	Average:62.46; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0628669362	NA	1.49E-39	mr1480	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628669362	NA	2.46E-18	mr1968	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628669362	NA	1.80E-10	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628669362	NA	1.47E-17	mr1557_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628669362	NA	4.79E-25	mr1653_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628669362	NA	9.39E-08	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628669362	NA	1.60E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628669362	NA	4.42E-13	mr1838_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628669362	NA	2.89E-21	mr1968_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251