| Variant ID: vg0628632221 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 28632221 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.56, G: 0.41, others allele: 0.00, population size: 41. )
TGTAATTTATCGTATCTATTCAGATCATACAGCATTGTCAGATCCATGATTTATTATGTTTACCTAGAGCATATTTTTTATACAATATCTATTGTGCAAG[T/G]
GTCCCCGATGTTAAATCGACTACGCTTTAACGTTGGGGGCTCGCTCTATTTTCTTCTGTATGAATCATGCTTGCTTACGGTTTACATAATGCCTGATATT
AATATCAGGCATTATGTAAACCGTAAGCAAGCATGATTCATACAGAAGAAAATAGAGCGAGCCCCCAACGTTAAAGCGTAGTCGATTTAACATCGGGGAC[A/C]
CTTGCACAATAGATATTGTATAAAAAATATGCTCTAGGTAAACATAATAAATCATGGATCTGACAATGCTGTATGATCTGAATAGATACGATAAATTACA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.80% | 46.10% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 36.40% | 63.50% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 6.30% | 93.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 56.50% | 43.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 12.90% | 87.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 36.80% | 63.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 34.60% | 65.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 51.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0628632221 | T -> G | LOC_Os06g47220.1 | upstream_gene_variant ; 2312.0bp to feature; MODIFIER | silent_mutation | Average:43.554; most accessible tissue: Minghui63 flower, score: 52.791 | N | N | N | N |
| vg0628632221 | T -> G | LOC_Os06g47210.1 | downstream_gene_variant ; 4215.0bp to feature; MODIFIER | silent_mutation | Average:43.554; most accessible tissue: Minghui63 flower, score: 52.791 | N | N | N | N |
| vg0628632221 | T -> G | LOC_Os06g47220-LOC_Os06g47230 | intergenic_region ; MODIFIER | silent_mutation | Average:43.554; most accessible tissue: Minghui63 flower, score: 52.791 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0628632221 | 1.73E-06 | NA | mr1216 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628632221 | 3.54E-06 | NA | mr1216 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628632221 | NA | 2.87E-06 | mr1231 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628632221 | NA | 6.48E-13 | mr1232 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628632221 | NA | 4.06E-23 | mr1557 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628632221 | NA | 2.26E-07 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628632221 | NA | 2.10E-18 | mr1557_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628632221 | NA | 6.78E-08 | mr1974_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628632221 | NA | 6.75E-07 | mr1974_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |