Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628613000:

Variant ID: vg0628613000 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 28613000
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.09, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:

CAGCAATTCTTTCTTCTTGAGTTGTTTCATTACCTCCTGCTGCTGTGGATGTCTTGGCCATCTCTGCCCACAGCTTATCAAGTGTTTCCGTTGCTCTTGC[T/C]
AAGTCACTTTCTTCCACTGCCTTTTCCCACTCTCTCTCGAGTGCAGCTGTCGCGCTTGCAAAAGCTCCTGTATAGCGTACTGGCACAGTCTTCTGTCGTT

Reverse complement sequence

AACGACAGAAGACTGTGCCAGTACGCTATACAGGAGCTTTTGCAAGCGCGACAGCTGCACTCGAGAGAGAGTGGGAAAAGGCAGTGGAAGAAAGTGACTT[A/G]
GCAAGAGCAACGGAAACACTTGATAAGCTGTGGGCAGAGATGGCCAAGACATCCACAGCAGCAGGAGGTAATGAAACAACTCAAGAAGAAAGAATTGCTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	22.50%	10.80%	35.76%	31.00%	NA
All Indica	2759	2.80%	0.80%	50.85%	45.63%	NA
All Japonica	1512	63.80%	30.40%	2.51%	3.31%	NA
Aus	269	0.40%	4.50%	56.13%	39.03%	NA
Indica I	595	9.20%	0.00%	27.90%	62.86%	NA
Indica II	465	1.10%	0.60%	45.81%	52.47%	NA
Indica III	913	0.80%	0.10%	72.18%	26.94%	NA
Indica Intermediate	786	1.10%	2.20%	46.44%	50.25%	NA
Temperate Japonica	767	87.00%	8.90%	2.48%	1.69%	NA
Tropical Japonica	504	23.80%	67.30%	2.18%	6.75%	NA
Japonica Intermediate	241	73.90%	21.60%	3.32%	1.24%	NA
VI/Aromatic	96	2.10%	1.00%	75.00%	21.88%	NA
Intermediate	90	18.90%	18.90%	28.89%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0628613000	T -> C	LOC_Os06g47180.1	upstream_gene_variant ; 1920.0bp to feature; MODIFIER	silent_mutation	Average:7.5; most accessible tissue: Callus, score: 27.001	N	N	N	N
vg0628613000	T -> C	LOC_Os06g47190.1	upstream_gene_variant ; 40.0bp to feature; MODIFIER	silent_mutation	Average:7.5; most accessible tissue: Callus, score: 27.001	N	N	N	N
vg0628613000	T -> C	LOC_Os06g47200.1	upstream_gene_variant ; 4447.0bp to feature; MODIFIER	silent_mutation	Average:7.5; most accessible tissue: Callus, score: 27.001	N	N	N	N
vg0628613000	T -> C	LOC_Os06g47200.3	upstream_gene_variant ; 4447.0bp to feature; MODIFIER	silent_mutation	Average:7.5; most accessible tissue: Callus, score: 27.001	N	N	N	N
vg0628613000	T -> C	LOC_Os06g47200.2	upstream_gene_variant ; 4447.0bp to feature; MODIFIER	silent_mutation	Average:7.5; most accessible tissue: Callus, score: 27.001	N	N	N	N
vg0628613000	T -> C	LOC_Os06g47190-LOC_Os06g47200	intergenic_region ; MODIFIER	silent_mutation	Average:7.5; most accessible tissue: Callus, score: 27.001	N	N	N	N
vg0628613000	T -> DEL	N	N	silent_mutation	Average:7.5; most accessible tissue: Callus, score: 27.001	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0628613000	NA	4.38E-06	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628613000	NA	4.26E-11	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628613000	NA	1.06E-07	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628613000	NA	3.82E-08	mr1742	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628613000	NA	1.88E-09	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628613000	NA	6.33E-10	mr1790	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628613000	NA	1.86E-08	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628613000	NA	4.01E-06	mr1892	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628613000	NA	5.74E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628613000	NA	2.06E-09	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628613000	3.85E-06	NA	mr1480_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628613000	NA	1.03E-07	mr1606_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628613000	NA	2.93E-25	mr1653_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628613000	NA	1.01E-11	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628613000	NA	2.14E-07	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251