Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628386367:

Variant ID: vg0628386367 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 28386367
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.10, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAAACCAGCGAAAAAAAAACCAAAATTATCCGATCCAAAAAAAATAGGGCGTTGCTCCCCTCAAAATGCTTCCTTGCTCTGTGTACTTTGTTCAACAG[G/A]
ATCAAGGGAAACAACTCTCCACTTATTTTTCCAGTGTCCTTTTAGCACTCAATGTTGGGCGTAATTTAGTGTGGTTTGGAATCTTTCTTTAAGCTTTGGT

Reverse complement sequence

ACCAAAGCTTAAAGAAAGATTCCAAACCACACTAAATTACGCCCAACATTGAGTGCTAAAAGGACACTGGAAAAATAAGTGGAGAGTTGTTTCCCTTGAT[C/T]
CTGTTGAACAAAGTACACAGAGCAAGGAAGCATTTTGAGGGGAGCAACGCCCTATTTTTTTTGGATCGGATAATTTTGGTTTTTTTTTCGCTGGTTTTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.50%	39.50%	0.00%	0.00%	NA
All Indica	2759	94.30%	5.70%	0.00%	0.00%	NA
All Japonica	1512	4.70%	95.30%	0.00%	0.00%	NA
Aus	269	51.30%	48.70%	0.00%	0.00%	NA
Indica I	595	98.00%	2.00%	0.00%	0.00%	NA
Indica II	465	93.80%	6.20%	0.00%	0.00%	NA
Indica III	913	95.40%	4.60%	0.00%	0.00%	NA
Indica Intermediate	786	90.50%	9.50%	0.00%	0.00%	NA
Temperate Japonica	767	3.30%	96.70%	0.00%	0.00%	NA
Tropical Japonica	504	7.90%	92.10%	0.00%	0.00%	NA
Japonica Intermediate	241	2.50%	97.50%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	54.40%	45.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0628386367	G -> A	LOC_Os06g46730.1	upstream_gene_variant ; 562.0bp to feature; MODIFIER	silent_mutation	Average:35.386; most accessible tissue: Zhenshan97 flower, score: 60.301	N	N	N	N
vg0628386367	G -> A	LOC_Os06g46720.1	downstream_gene_variant ; 3878.0bp to feature; MODIFIER	silent_mutation	Average:35.386; most accessible tissue: Zhenshan97 flower, score: 60.301	N	N	N	N
vg0628386367	G -> A	LOC_Os06g46740.1	downstream_gene_variant ; 1929.0bp to feature; MODIFIER	silent_mutation	Average:35.386; most accessible tissue: Zhenshan97 flower, score: 60.301	N	N	N	N
vg0628386367	G -> A	LOC_Os06g46754.1	downstream_gene_variant ; 3964.0bp to feature; MODIFIER	silent_mutation	Average:35.386; most accessible tissue: Zhenshan97 flower, score: 60.301	N	N	N	N
vg0628386367	G -> A	LOC_Os06g46754.2	downstream_gene_variant ; 3964.0bp to feature; MODIFIER	silent_mutation	Average:35.386; most accessible tissue: Zhenshan97 flower, score: 60.301	N	N	N	N
vg0628386367	G -> A	LOC_Os06g46730-LOC_Os06g46740	intergenic_region ; MODIFIER	silent_mutation	Average:35.386; most accessible tissue: Zhenshan97 flower, score: 60.301	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0628386367	3.45E-06	NA	mr1166	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628386367	NA	5.29E-06	mr1210	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628386367	NA	8.36E-06	mr1305	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628386367	NA	1.45E-08	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628386367	NA	6.86E-19	mr1566	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628386367	NA	6.64E-07	mr1586	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628386367	NA	8.49E-19	mr1598	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628386367	NA	1.11E-12	mr1609	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628386367	NA	4.19E-23	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251