Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0627481470:

Variant ID: vg0627481470 (JBrowse)	Variation Type: INDEL
Chromosome: chr06	Position: 27481470
Reference Allele: GC	Alternative Allele: G,AC
Primary Allele: GC	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCACACGCGCGGGTCCATGTCGTCCGCTGCCGAGGCGGACGACGTCGACGACGGCAGAGGCGGCAGCCGGCGAGGGTTCATCATGGTCGTCGTCGTCGGC[GC/G,AC]
GCGGCGTCGTCAGCTGCAGCTGCGTGAGCTGAAAATTTTCAAGGGTGAAGTGGAGTGGAGTGAGGCAGCTGTGAAGCGGCAGCTGCGATCAAATGATAGT

Reverse complement sequence

ACTATCATTTGATCGCAGCTGCCGCTTCACAGCTGCCTCACTCCACTCCACTTCACCCTTGAAAATTTTCAGCTCACGCAGCTGCAGCTGACGACGCCGC[GC/C,GT]
GCCGACGACGACGACCATGATGAACCCTCGCCGGCTGCCGCCTCTGCCGTCGTCGACGTCGTCCGCCTCGGCAGCGGACGACATGGACCCGCGCGTGTGG

Allele Frequencies:

Populations	Population Size	Frequency of GC(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.50%	9.00%	0.53%	0.00%	AC: 0.99%
All Indica	2759	92.00%	7.90%	0.00%	0.00%	AC: 0.04%
All Japonica	1512	95.60%	0.20%	1.32%	0.00%	AC: 2.84%
Aus	269	29.40%	69.90%	0.74%	0.00%	NA
Indica I	595	98.30%	1.70%	0.00%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	84.10%	15.90%	0.00%	0.00%	NA
Indica Intermediate	786	92.90%	7.00%	0.00%	0.00%	AC: 0.13%
Temperate Japonica	767	99.20%	0.00%	0.65%	0.00%	AC: 0.13%
Tropical Japonica	504	89.10%	0.20%	2.38%	0.00%	AC: 8.33%
Japonica Intermediate	241	97.90%	0.80%	1.24%	0.00%	NA
VI/Aromatic	96	92.70%	4.20%	2.08%	0.00%	AC: 1.04%
Intermediate	90	86.70%	10.00%	1.11%	0.00%	AC: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0627481470	GC -> G	LOC_Os06g45460.1	upstream_gene_variant ; 84.0bp to feature; MODIFIER	silent_mutation	Average:73.022; most accessible tissue: Zhenshan97 flower, score: 80.904	N	N	N	N
vg0627481470	GC -> G	LOC_Os06g45460-LOC_Os06g45470	intergenic_region ; MODIFIER	silent_mutation	Average:73.022; most accessible tissue: Zhenshan97 flower, score: 80.904	N	N	N	N
vg0627481470	GC -> AC	LOC_Os06g45460.1	upstream_gene_variant ; 83.0bp to feature; MODIFIER	silent_mutation	Average:73.022; most accessible tissue: Zhenshan97 flower, score: 80.904	N	N	N	N
vg0627481470	GC -> AC	LOC_Os06g45460-LOC_Os06g45470	intergenic_region ; MODIFIER	silent_mutation	Average:73.022; most accessible tissue: Zhenshan97 flower, score: 80.904	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0627481470	NA	6.36E-07	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627481470	NA	2.45E-08	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627481470	NA	1.16E-09	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627481470	NA	4.63E-06	mr1107	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627481470	2.30E-06	2.30E-06	mr1145	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627481470	9.66E-06	9.65E-06	mr1204	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627481470	NA	3.09E-07	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627481470	NA	3.42E-06	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627481470	NA	1.01E-06	mr1104_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627481470	NA	1.74E-07	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251