Search for Variation information by Variation ID:
Detailed information for vg0626921887:
| Variant ID: vg0626921887 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 26921887 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
AGGTCTTGGTTTTGAGGCCCTTGAGGATTTCCGCGTTGGCGCGCTCCACTTGGCCATTGCTTTTAGGGTGGGTGGGGGAGGCGAAGCAGAGCTTGATGCC[C/T]
ATGTCTTCGCAGTAGTCACCGAAGAGTTCACTAGTGAACTGGGTGCCGTTATCCGTAATGATACGGTTAGGCACCCCAAACTGAGCAGTGATGCCCCTGA
Reverse complement sequence
TCAGGGGCATCACTGCTCAGTTTGGGGTGCCTAACCGTATCATTACGGATAACGGCACCCAGTTCACTAGTGAACTCTTCGGTGACTACTGCGAAGACAT[G/A]
GGCATCAAGCTCTGCTTCGCCTCCCCCACCCACCCTAAAAGCAATGGCCAAGTGGAGCGCGCCAACGCGGAAATCCTCAAGGGCCTCAAAACCAAGACCT
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 28.60% | 3.70% | 14.77% | 52.94% | NA |
| All Indica | 2759 | 2.80% | 0.30% | 20.73% | 76.19% | NA |
| All Japonica | 1512 | 79.40% | 10.80% | 5.36% | 4.43% | NA |
| Aus | 269 | 13.80% | 0.00% | 4.83% | 81.41% | NA |
| Indica I | 595 | 0.50% | 0.00% | 7.56% | 91.93% | NA |
| Indica II | 465 | 4.10% | 1.50% | 12.26% | 82.15% | NA |
| Indica III | 913 | 0.80% | 0.00% | 40.09% | 59.15% | NA |
| Indica Intermediate | 786 | 6.10% | 0.10% | 13.23% | 80.53% | NA |
| Temperate Japonica | 767 | 97.50% | 1.20% | 0.52% | 0.78% | NA |
| Tropical Japonica | 504 | 47.40% | 28.00% | 13.89% | 10.71% | NA |
| Japonica Intermediate | 241 | 88.80% | 5.40% | 2.90% | 2.90% | NA |
| VI/Aromatic | 96 | 5.20% | 0.00% | 25.00% | 69.79% | NA |
| Intermediate | 90 | 33.30% | 5.60% | 8.89% | 52.22% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0626921887 | C -> T | LOC_Os06g44590.1 | missense_variant ; p.Met1721Ile; MODERATE | nonsynonymous_codon ; M1721I | Average:4.918; most accessible tissue: Minghui63 panicle, score: 7.125 | benign  |
0.264 |
DELETERIOUS | 0.00 |
| vg0626921887 | C -> DEL | LOC_Os06g44590.1 | N | frameshift_variant | Average:4.918; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0626921887 | 8.29E-07 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626921887 | 5.81E-06 | NA | mr1085_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626921887 | 5.82E-06 | NA | mr1283_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626921887 | NA | 7.80E-06 | mr1562_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626921887 | 1.10E-06 | 1.79E-09 | mr1696_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626921887 | NA | 5.54E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626921887 | NA | 4.29E-07 | mr1849_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |