Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0626887934:

Variant ID: vg0626887934 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 26887934
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.04, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:

CCGAGATTTAGTCAACTACTATTAGGTATGTGGTATCCATAACCCTGACAGTATCCCCCGACTTCAATGCAAATGAACGAATTCATATTCTCAACTGCGC[G/A]
CAGACATTGGAGTAACTGTTATCGAGCTCATGTGACCGTTCTCGGTGAGTTTAGAGATAACGTTGGACTTCCTTTGTCAGCCTCGTGCGGGCACCGAAAG

Reverse complement sequence

CTTTCGGTGCCCGCACGAGGCTGACAAAGGAAGTCCAACGTTATCTCTAAACTCACCGAGAACGGTCACATGAGCTCGATAACAGTTACTCCAATGTCTG[C/T]
GCGCAGTTGAGAATATGAATTCGTTCATTTGCATTGAAGTCGGGGGATACTGTCAGGGTTATGGATACCACATACCTAATAGTAGTTGACTAAATCTCGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.10%	36.30%	4.00%	0.61%	NA
All Indica	2759	93.80%	2.80%	3.04%	0.33%	NA
All Japonica	1512	1.10%	98.80%	0.13%	0.00%	NA
Aus	269	53.20%	5.20%	34.57%	7.06%	NA
Indica I	595	99.70%	0.20%	0.17%	0.00%	NA
Indica II	465	93.10%	5.20%	1.72%	0.00%	NA
Indica III	913	92.70%	0.40%	6.35%	0.55%	NA
Indica Intermediate	786	91.10%	6.20%	2.16%	0.51%	NA
Temperate Japonica	767	1.00%	99.00%	0.00%	0.00%	NA
Tropical Japonica	504	1.40%	98.40%	0.20%	0.00%	NA
Japonica Intermediate	241	0.40%	99.20%	0.41%	0.00%	NA
VI/Aromatic	96	7.30%	89.60%	3.12%	0.00%	NA
Intermediate	90	42.20%	48.90%	7.78%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0626887934	G -> A	LOC_Os06g44510.1	downstream_gene_variant ; 1789.0bp to feature; MODIFIER	silent_mutation	Average:25.614; most accessible tissue: Minghui63 flag leaf, score: 36.591	N	N	N	N
vg0626887934	G -> A	LOC_Os06g44530.1	downstream_gene_variant ; 2681.0bp to feature; MODIFIER	silent_mutation	Average:25.614; most accessible tissue: Minghui63 flag leaf, score: 36.591	N	N	N	N
vg0626887934	G -> A	LOC_Os06g44510-LOC_Os06g44530	intergenic_region ; MODIFIER	silent_mutation	Average:25.614; most accessible tissue: Minghui63 flag leaf, score: 36.591	N	N	N	N
vg0626887934	G -> DEL	N	N	silent_mutation	Average:25.614; most accessible tissue: Minghui63 flag leaf, score: 36.591	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0626887934	NA	4.80E-07	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626887934	1.36E-06	1.36E-06	mr1417	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626887934	2.32E-06	2.32E-06	mr1507	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626887934	NA	5.75E-08	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626887934	NA	5.75E-08	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626887934	NA	9.27E-08	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626887934	3.51E-06	3.51E-06	mr1810	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626887934	NA	1.41E-07	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626887934	4.19E-06	4.19E-06	mr1824	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626887934	NA	2.78E-07	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251