Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0626826472:

Variant ID: vg0626826472 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 26826472
Reference Allele: A	Alternative Allele: G,T
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.74, A: 0.25, T: 0.01, others allele: 0.00, population size: 163. )

Flanking Sequence (100 bp) in Reference Genome:

CACACAGACCAATGATAAATAATTACTCCCTCCAGTTCTATATTAATTGACGTTTTAGACAGTATTGCAAATACCAATAACTTATTAATTAGATCCATAT[A/G,T]
TCCTGTTATACCCTTATTAAATATACTCCAACTATCTCATCTGGTTAGCGCCACCATTCCCAAAGTGTGAGGTTCTGTGTTCGAGAACTAATACTGTAAG

Reverse complement sequence

CTTACAGTATTAGTTCTCGAACACAGAACCTCACACTTTGGGAATGGTGGCGCTAACCAGATGAGATAGTTGGAGTATATTTAATAAGGGTATAACAGGA[T/C,A]
ATATGGATCTAATTAATAAGTTATTGGTATTTGCAATACTGTCTAAAACGTCAATTAATATAGAACTGGAGGGAGTAATTATTTATCATTGGTCTGTGTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.70%	11.20%	0.06%	0.00%	T: 0.04%
All Indica	2759	91.20%	8.70%	0.07%	0.00%	NA
All Japonica	1512	94.20%	5.80%	0.00%	0.00%	NA
Aus	269	34.20%	65.40%	0.37%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	97.20%	2.60%	0.22%	0.00%	NA
Indica III	913	81.20%	18.70%	0.11%	0.00%	NA
Indica Intermediate	786	92.90%	7.10%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	83.90%	16.10%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	2.50%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	74.40%	23.30%	0.00%	0.00%	T: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0626826472	A -> G	LOC_Os06g44420.1	upstream_gene_variant ; 3055.0bp to feature; MODIFIER	silent_mutation	Average:49.238; most accessible tissue: Minghui63 root, score: 74.461	N	N	N	N
vg0626826472	A -> G	LOC_Os06g44410-LOC_Os06g44420	intergenic_region ; MODIFIER	silent_mutation	Average:49.238; most accessible tissue: Minghui63 root, score: 74.461	N	N	N	N
vg0626826472	A -> T	LOC_Os06g44420.1	upstream_gene_variant ; 3055.0bp to feature; MODIFIER	silent_mutation	Average:49.238; most accessible tissue: Minghui63 root, score: 74.461	N	N	N	N
vg0626826472	A -> T	LOC_Os06g44410-LOC_Os06g44420	intergenic_region ; MODIFIER	silent_mutation	Average:49.238; most accessible tissue: Minghui63 root, score: 74.461	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0626826472	NA	6.07E-07	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626826472	NA	6.03E-07	mr1049_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626826472	NA	2.50E-06	mr1291_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626826472	NA	4.39E-07	mr1344_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626826472	NA	8.83E-06	mr1597_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626826472	NA	7.17E-06	mr1704_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626826472	NA	5.10E-10	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626826472	NA	4.69E-06	mr1892_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626826472	4.70E-06	4.70E-06	mr1981_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251