Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0626644874:

Variant ID: vg0626644874 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 26644874
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

CCCGACGCCTGCAGCCGTCGTCTTGCCGTCCGTCCGCCGTACGCCGCCAGCGCCCTTCGTCATCGTCGCCATTCGTCAGCACGCCGTCCGCCGCCAGCAC[G/A]
CCATCCGCCGACCATGAATATGTTGTTTAACCGGGGACGAGGAAACCACGGGGATAAATTCACCGCGTGGTGAACGGGGCTGGAGAAAATATATCCCCGT

Reverse complement sequence

ACGGGGATATATTTTCTCCAGCCCCGTTCACCACGCGGTGAATTTATCCCCGTGGTTTCCTCGTCCCCGGTTAAACAACATATTCATGGTCGGCGGATGG[C/T]
GTGCTGGCGGCGGACGGCGTGCTGACGAATGGCGACGATGACGAAGGGCGCTGGCGGCGTACGGCGGACGGACGGCAAGACGACGGCTGCAGGCGTCGGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.60%	49.40%	0.02%	0.00%	NA
All Indica	2759	18.10%	81.90%	0.00%	0.00%	NA
All Japonica	1512	98.80%	1.10%	0.07%	0.00%	NA
Aus	269	91.10%	8.90%	0.00%	0.00%	NA
Indica I	595	3.20%	96.80%	0.00%	0.00%	NA
Indica II	465	23.70%	76.30%	0.00%	0.00%	NA
Indica III	913	24.00%	76.00%	0.00%	0.00%	NA
Indica Intermediate	786	19.20%	80.80%	0.00%	0.00%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	98.40%	1.40%	0.20%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	66.70%	33.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0626644874	G -> A	LOC_Os06g44160.1	downstream_gene_variant ; 1450.0bp to feature; MODIFIER	silent_mutation	Average:85.187; most accessible tissue: Minghui63 flag leaf, score: 96.4	N	N	N	N
vg0626644874	G -> A	LOC_Os06g44160.2	downstream_gene_variant ; 1450.0bp to feature; MODIFIER	silent_mutation	Average:85.187; most accessible tissue: Minghui63 flag leaf, score: 96.4	N	N	N	N
vg0626644874	G -> A	LOC_Os06g44150-LOC_Os06g44160	intergenic_region ; MODIFIER	silent_mutation	Average:85.187; most accessible tissue: Minghui63 flag leaf, score: 96.4	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0626644874	G	A	0.02	0.0	0.01	0.02	0.03	0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0626644874	NA	3.63E-13	mr1531	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626644874	NA	1.26E-06	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626644874	NA	3.21E-18	mr1131_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626644874	NA	8.48E-14	mr1147_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626644874	NA	1.79E-36	mr1208_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626644874	NA	1.63E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626644874	NA	4.36E-20	mr1531_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626644874	NA	3.37E-07	mr1705_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626644874	NA	4.30E-06	mr1762_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626644874	NA	1.07E-07	mr1795_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626644874	NA	9.81E-39	mr1878_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626644874	NA	2.85E-08	mr1878_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626644874	NA	2.04E-06	mr1901_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626644874	NA	1.56E-07	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626644874	NA	1.10E-22	mr1949_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251