Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0626417085:

Variant ID: vg0626417085 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 26417085
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TTCGTCTTATTCAAAAAATTTACGTAATTATAATTTATTTTGTTATGAGTTGTTTTATTACTTATAGTACTTTAAATGTGATTTATATCTTATACATTTG[C/T]
ATAAAATTTTTGAATAAAATGAATGGTCAAATATGTGAGAAAAAGTCAACGGCATTATCTATTATAAAACGGAGGGAATAAGAACTAACAAACTTTTCAT

Reverse complement sequence

ATGAAAAGTTTGTTAGTTCTTATTCCCTCCGTTTTATAATAGATAATGCCGTTGACTTTTTCTCACATATTTGACCATTCATTTTATTCAAAAATTTTAT[G/A]
CAAATGTATAAGATATAAATCACATTTAAAGTACTATAAGTAATAAAACAACTCATAACAAAATAAATTATAATTACGTAAATTTTTTGAATAAGACGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.20% 48.70% 0.11% 0.00% NA
All Indica  2759 20.60% 79.20% 0.18% 0.00% NA
All Japonica  1512 98.70% 1.30% 0.00% 0.00% NA
Aus  269 77.70% 22.30% 0.00% 0.00% NA
Indica I  595 10.30% 89.60% 0.17% 0.00% NA
Indica II  465 58.90% 41.10% 0.00% 0.00% NA
Indica III  913 5.90% 93.90% 0.22% 0.00% NA
Indica Intermediate  786 22.80% 77.00% 0.25% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 97.40% 2.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0626417085 C -> T LOC_Os06g43860.1 upstream_gene_variant ; 2250.0bp to feature; MODIFIER silent_mutation Average:92.682; most accessible tissue: Zhenshan97 young leaf, score: 98.381 N N N N
vg0626417085 C -> T LOC_Os06g43860.4 upstream_gene_variant ; 3695.0bp to feature; MODIFIER silent_mutation Average:92.682; most accessible tissue: Zhenshan97 young leaf, score: 98.381 N N N N
vg0626417085 C -> T LOC_Os06g43860.2 upstream_gene_variant ; 2250.0bp to feature; MODIFIER silent_mutation Average:92.682; most accessible tissue: Zhenshan97 young leaf, score: 98.381 N N N N
vg0626417085 C -> T LOC_Os06g43870.2 downstream_gene_variant ; 4427.0bp to feature; MODIFIER silent_mutation Average:92.682; most accessible tissue: Zhenshan97 young leaf, score: 98.381 N N N N
vg0626417085 C -> T LOC_Os06g43860-LOC_Os06g43870 intergenic_region ; MODIFIER silent_mutation Average:92.682; most accessible tissue: Zhenshan97 young leaf, score: 98.381 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0626417085 C T 0.01 0.01 0.0 0.0 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0626417085 NA 3.46E-08 mr1003 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626417085 NA 1.98E-06 mr1010 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626417085 NA 3.31E-09 mr1051 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626417085 NA 5.87E-06 mr1163 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626417085 NA 8.32E-08 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626417085 NA 5.50E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626417085 NA 2.57E-06 mr1051_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626417085 NA 3.50E-06 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251