Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0626324304:

Variant ID: vg0626324304 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 26324304
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.05, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

AGATATGTAGCCAGCTACAGCACGGATTCCAAGACATAATGTGTATATGATAGGTGGGACCATATATTAGTAGTAAAGTAATCAACTATTATATAAATTG[G/A]
CTATTAGATTGACTATAGATAAATTGGAGCTAATAGTGGGCTATAATATTAAACTTCTCTTAAGATCAACGATTGGTGTCACTTGGTTGGGTACACGTAC

Reverse complement sequence

GTACGTGTACCCAACCAAGTGACACCAATCGTTGATCTTAAGAGAAGTTTAATATTATAGCCCACTATTAGCTCCAATTTATCTATAGTCAATCTAATAG[C/T]
CAATTTATATAATAGTTGATTACTTTACTACTAATATATGGTCCCACCTATCATATACACATTATGTCTTGGAATCCGTGCTGTAGCTGGCTACATATCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.40%	14.30%	0.23%	0.00%	NA
All Indica	2759	82.80%	16.90%	0.36%	0.00%	NA
All Japonica	1512	98.40%	1.50%	0.07%	0.00%	NA
Aus	269	34.90%	65.10%	0.00%	0.00%	NA
Indica I	595	89.90%	9.90%	0.17%	0.00%	NA
Indica II	465	47.30%	51.60%	1.08%	0.00%	NA
Indica III	913	95.40%	4.60%	0.00%	0.00%	NA
Indica Intermediate	786	83.70%	15.80%	0.51%	0.00%	NA
Temperate Japonica	767	99.60%	0.30%	0.13%	0.00%	NA
Tropical Japonica	504	96.20%	3.80%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0626324304	G -> A	LOC_Os06g43740.1	upstream_gene_variant ; 211.0bp to feature; MODIFIER	silent_mutation	Average:80.639; most accessible tissue: Callus, score: 96.666	N	N	N	N
vg0626324304	G -> A	LOC_Os06g43720.1	downstream_gene_variant ; 4121.0bp to feature; MODIFIER	silent_mutation	Average:80.639; most accessible tissue: Callus, score: 96.666	N	N	N	N
vg0626324304	G -> A	LOC_Os06g43730.1	downstream_gene_variant ; 2745.0bp to feature; MODIFIER	silent_mutation	Average:80.639; most accessible tissue: Callus, score: 96.666	N	N	N	N
vg0626324304	G -> A	LOC_Os06g43750.1	downstream_gene_variant ; 1863.0bp to feature; MODIFIER	silent_mutation	Average:80.639; most accessible tissue: Callus, score: 96.666	N	N	N	N
vg0626324304	G -> A	LOC_Os06g43740-LOC_Os06g43750	intergenic_region ; MODIFIER	silent_mutation	Average:80.639; most accessible tissue: Callus, score: 96.666	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0626324304	G	A	-0.02	-0.06	-0.07	-0.04	-0.08	-0.07

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0626324304	NA	8.51E-07	mr1003	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626324304	NA	5.43E-06	mr1010	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626324304	NA	6.06E-08	mr1051	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626324304	NA	2.36E-06	mr1064	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626324304	NA	8.11E-07	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626324304	NA	2.37E-06	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626324304	NA	3.89E-10	mr1536	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626324304	NA	2.05E-08	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626324304	NA	9.50E-06	mr1671	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626324304	NA	8.39E-06	mr1887	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626324304	NA	3.41E-06	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626324304	NA	3.08E-06	mr1051_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626324304	NA	1.84E-07	mr1536_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626324304	NA	6.75E-06	mr1974_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251