| Variant ID: vg0625603773 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 25603773 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTGCTGCCACGTGAACGAACGAACGATCGTGAACGAACGAAACGTACGTGAATGTGAACGAACGAACGAACGTACGTGAACGTGAACGTGAACGAACGAA[C/T]
GTACGTTAACGTGAACGTGAACGAACGAACGTACGTTAACGAAGGAAACATACATGAATGAGAACGTGAACGAACAAACGTACGTGAACGTGAACCTAAC
GTTAGGTTCACGTTCACGTACGTTTGTTCGTTCACGTTCTCATTCATGTATGTTTCCTTCGTTAACGTACGTTCGTTCGTTCACGTTCACGTTAACGTAC[G/A]
TTCGTTCGTTCACGTTCACGTTCACGTACGTTCGTTCGTTCGTTCACATTCACGTACGTTTCGTTCGTTCACGATCGTTCGTTCGTTCACGTGGCAGCAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.20% | 1.70% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 94.70% | 5.00% | 0.33% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.70% | 1.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.10% | 18.70% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0625603773 | C -> T | LOC_Os06g42580.1 | upstream_gene_variant ; 3816.0bp to feature; MODIFIER | silent_mutation | Average:37.473; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0625603773 | C -> T | LOC_Os06g42570.1 | downstream_gene_variant ; 1559.0bp to feature; MODIFIER | silent_mutation | Average:37.473; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0625603773 | C -> T | LOC_Os06g42570-LOC_Os06g42580 | intergenic_region ; MODIFIER | silent_mutation | Average:37.473; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0625603773 | 6.80E-07 | 6.80E-07 | mr1098 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625603773 | 4.99E-06 | 4.99E-06 | mr1099 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625603773 | NA | 5.33E-07 | mr1101 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625603773 | NA | 8.02E-06 | mr1113 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625603773 | NA | 5.62E-06 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625603773 | NA | 9.08E-06 | mr1116 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625603773 | NA | 2.15E-06 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625603773 | NA | 2.35E-06 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625603773 | NA | 4.65E-06 | mr1119 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625603773 | NA | 1.98E-06 | mr1120 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/