Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0625175765:

Variant ID: vg0625175765 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 25175765
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.84, A: 0.14, C: 0.02, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TATTAAGTTTAAAATTTTGGGTTCATGTTAACTAGGTATTTTCTTTTGAAAAAGATAGTATAGATCATACAAATCACAAGGAAGCGAGATATATGACATG[T/A]
CTTTATTAATTTATATATAAGTATGTAACAACTTACATGAACTTAAACCAACTAGAAGGAGAAATACTTGATGGTACAAATATAACATATTTATTAACAA

Reverse complement sequence

TTGTTAATAAATATGTTATATTTGTACCATCAAGTATTTCTCCTTCTAGTTGGTTTAAGTTCATGTAAGTTGTTACATACTTATATATAAATTAATAAAG[A/T]
CATGTCATATATCTCGCTTCCTTGTGATTTGTATGATCTATACTATCTTTTTCAAAAGAAAATACCTAGTTAACATGAACCCAAAATTTTAAACTTAATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.10% 10.90% 0.08% 0.00% NA
All Indica  2759 98.00% 2.00% 0.04% 0.00% NA
All Japonica  1512 70.10% 29.70% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 95.90% 4.10% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 95.80% 4.10% 0.13% 0.00% NA
Temperate Japonica  767 89.20% 10.60% 0.26% 0.00% NA
Tropical Japonica  504 53.00% 47.00% 0.00% 0.00% NA
Japonica Intermediate  241 45.20% 54.40% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0625175765 T -> A LOC_Os06g41940.1 downstream_gene_variant ; 2872.0bp to feature; MODIFIER silent_mutation Average:28.965; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0625175765 T -> A LOC_Os06g41950.1 intron_variant ; MODIFIER silent_mutation Average:28.965; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0625175765 2.13E-06 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625175765 4.34E-06 NA mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625175765 2.13E-06 NA mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625175765 3.79E-06 NA mr1104 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625175765 3.18E-06 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625175765 8.39E-06 NA mr1139 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625175765 1.35E-07 NA mr1204 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625175765 4.18E-07 NA mr1213 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625175765 5.30E-08 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625175765 NA 1.15E-07 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625175765 1.67E-09 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625175765 1.48E-06 NA mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625175765 1.61E-06 1.64E-12 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625175765 8.25E-06 NA mr1070_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625175765 2.41E-06 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625175765 1.64E-06 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625175765 4.06E-07 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625175765 3.05E-06 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625175765 3.39E-06 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625175765 NA 9.36E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625175765 NA 2.79E-06 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251