| Variant ID: vg0624696649 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 24696649 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CCTTTCGGTGTCGCCCCGCGCCCGTTGTGCGGTTGTCGACCCCGGTGCCCGTGTACCGGTGTCGGTAGTCGTTCGTGGGTGCGTGTGGTGACCGTGTTTG[T/C]
GTGCCCGCTCGGTAGCCACGTGGTGTCCACGTGTGTAGTCCGCGTGGTGTCTAGTGGAGTCCGTTTGTCGGCCACTCGCCTCGGTTGACACACGGGGTCC
GGACCCCGTGTGTCAACCGAGGCGAGTGGCCGACAAACGGACTCCACTAGACACCACGCGGACTACACACGTGGACACCACGTGGCTACCGAGCGGGCAC[A/G]
CAAACACGGTCACCACACGCACCCACGAACGACTACCGACACCGGTACACGGGCACCGGGGTCGACAACCGCACAACGGGCGCGGGGCGACACCGAAAGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.00% | 1.60% | 2.39% | 0.00% | NA |
| All Indica | 2759 | 98.70% | 0.60% | 0.72% | 0.00% | NA |
| All Japonica | 1512 | 90.60% | 3.40% | 5.95% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 0.90% | 1.51% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.80% | 1.50% | 1.65% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 73.80% | 8.90% | 17.26% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 2.50% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 5.60% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0624696649 | T -> C | LOC_Os06g41260.1 | upstream_gene_variant ; 3008.0bp to feature; MODIFIER | silent_mutation | Average:61.522; most accessible tissue: Minghui63 young leaf, score: 81.5 | N | N | N | N |
| vg0624696649 | T -> C | LOC_Os06g41270.1 | upstream_gene_variant ; 572.0bp to feature; MODIFIER | silent_mutation | Average:61.522; most accessible tissue: Minghui63 young leaf, score: 81.5 | N | N | N | N |
| vg0624696649 | T -> C | LOC_Os06g41270-LOC_Os06g41280 | intergenic_region ; MODIFIER | silent_mutation | Average:61.522; most accessible tissue: Minghui63 young leaf, score: 81.5 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0624696649 | NA | 1.60E-06 | mr1218 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624696649 | NA | 3.72E-08 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624696649 | 9.54E-07 | 5.24E-11 | mr1583 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624696649 | NA | 8.86E-06 | mr1218_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624696649 | 4.73E-11 | 3.71E-14 | mr1850_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |