Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0624640412:

Variant ID: vg0624640412 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 24640412
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, G: 0.11, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:

CTTAGCCCAACTTTTAATTTCTAACACACTAATATACGGAAATGTACATGCTTCCAAGGCTCGGAGTGCGAACATGCATGGACACATCCCATATTTTTTT[T/G]
TCCAAGATCTACTACAAAGTATACAAAATACAATGATGCATTGATGTGTCCAGAAGCATATATGGTTGGCTGAGTTGTTTAATTATGTTGCGATCTTCTC

Reverse complement sequence

GAGAAGATCGCAACATAATTAAACAACTCAGCCAACCATATATGCTTCTGGACACATCAATGCATCATTGTATTTTGTATACTTTGTAGTAGATCTTGGA[A/C]
AAAAAAATATGGGATGTGTCCATGCATGTTCGCACTCCGAGCCTTGGAAGCATGTACATTTCCGTATATTAGTGTGTTAGAAATTAAAAGTTGGGCTAAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.30%	8.10%	0.49%	53.13%	NA
All Indica	2759	5.80%	5.30%	0.80%	88.18%	NA
All Japonica	1512	99.20%	0.00%	0.07%	0.73%	NA
Aus	269	5.60%	81.00%	0.00%	13.38%	NA
Indica I	595	2.20%	0.20%	1.01%	96.64%	NA
Indica II	465	8.00%	2.40%	1.08%	88.60%	NA
Indica III	913	2.40%	10.80%	0.44%	86.31%	NA
Indica Intermediate	786	11.10%	4.30%	0.89%	83.72%	NA
Temperate Japonica	767	99.00%	0.00%	0.13%	0.91%	NA
Tropical Japonica	504	99.40%	0.00%	0.00%	0.60%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	84.40%	15.60%	0.00%	0.00%	NA
Intermediate	90	60.00%	5.60%	0.00%	34.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0624640412	T -> G	LOC_Os06g41170.1	upstream_gene_variant ; 4304.0bp to feature; MODIFIER	silent_mutation	Average:9.699; most accessible tissue: Callus, score: 49.497	N	N	N	N
vg0624640412	T -> G	LOC_Os06g41180.1	downstream_gene_variant ; 2595.0bp to feature; MODIFIER	silent_mutation	Average:9.699; most accessible tissue: Callus, score: 49.497	N	N	N	N
vg0624640412	T -> G	LOC_Os06g41180-LOC_Os06g41190	intergenic_region ; MODIFIER	silent_mutation	Average:9.699; most accessible tissue: Callus, score: 49.497	N	N	N	N
vg0624640412	T -> DEL	N	N	silent_mutation	Average:9.699; most accessible tissue: Callus, score: 49.497	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0624640412	NA	7.23E-08	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624640412	NA	2.17E-06	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624640412	NA	1.68E-07	mr1367	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624640412	NA	6.56E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624640412	3.36E-06	3.35E-06	mr1459	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624640412	NA	5.86E-06	mr1523	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624640412	NA	4.67E-08	mr1669	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624640412	NA	4.36E-11	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251