| Variant ID: vg0623519091 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 23519091 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 281. )
TTTGGGTAACGTGATAAAAGATCAGTTCTCCATTAGTGATATAAATGGTGCTTTCCTAACATGTGCAATTTTTCCTGTCTCCTAAGTTTGTACTTCCTCT[G/A,T]
TTTCACAATGTAAGTCATTCTAGCATTTCCCACATTCATATTGATGTTAATGAATCCATATAGATATATATGTCTAGATTCATTAACATCAATATAAATA
TATTTATATTGATGTTAATGAATCTAGACATATATATCTATATGGATTCATTAACATCAATATGAATGTGGGAAATGCTAGAATGACTTACATTGTGAAA[C/T,A]
AGAGGAAGTACAAACTTAGGAGACAGGAAAAATTGCACATGTTAGGAAAGCACCATTTATATCACTAATGGAGAACTGATCTTTTATCACGTTACCCAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.40% | 3.20% | 1.42% | 0.00% | NA |
| All Indica | 2759 | 98.40% | 1.40% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 88.90% | 7.10% | 3.97% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 96.30% | 3.20% | 0.43% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.80% | 2.90% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 94.10% | 0.50% | 5.35% | 0.00% | NA |
| Tropical Japonica | 504 | 80.00% | 17.90% | 2.18% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.90% | 5.80% | 3.32% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 6.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0623519091 | G -> T | LOC_Os06g39610.1 | upstream_gene_variant ; 4146.0bp to feature; MODIFIER | N | Average:29.658; most accessible tissue: Zhenshan97 young leaf, score: 47.986 | N | N | N | N |
| vg0623519091 | G -> T | LOC_Os06g39624.1 | upstream_gene_variant ; 2845.0bp to feature; MODIFIER | N | Average:29.658; most accessible tissue: Zhenshan97 young leaf, score: 47.986 | N | N | N | N |
| vg0623519091 | G -> T | LOC_Os06g39624.3 | upstream_gene_variant ; 2845.0bp to feature; MODIFIER | N | Average:29.658; most accessible tissue: Zhenshan97 young leaf, score: 47.986 | N | N | N | N |
| vg0623519091 | G -> T | LOC_Os06g39624.2 | upstream_gene_variant ; 2845.0bp to feature; MODIFIER | N | Average:29.658; most accessible tissue: Zhenshan97 young leaf, score: 47.986 | N | N | N | N |
| vg0623519091 | G -> T | LOC_Os06g39610-LOC_Os06g39624 | intergenic_region ; MODIFIER | N | Average:29.658; most accessible tissue: Zhenshan97 young leaf, score: 47.986 | N | N | N | N |
| vg0623519091 | G -> A | LOC_Os06g39610.1 | upstream_gene_variant ; 4146.0bp to feature; MODIFIER | silent_mutation | Average:29.658; most accessible tissue: Zhenshan97 young leaf, score: 47.986 | N | N | N | N |
| vg0623519091 | G -> A | LOC_Os06g39624.1 | upstream_gene_variant ; 2845.0bp to feature; MODIFIER | silent_mutation | Average:29.658; most accessible tissue: Zhenshan97 young leaf, score: 47.986 | N | N | N | N |
| vg0623519091 | G -> A | LOC_Os06g39624.3 | upstream_gene_variant ; 2845.0bp to feature; MODIFIER | silent_mutation | Average:29.658; most accessible tissue: Zhenshan97 young leaf, score: 47.986 | N | N | N | N |
| vg0623519091 | G -> A | LOC_Os06g39624.2 | upstream_gene_variant ; 2845.0bp to feature; MODIFIER | silent_mutation | Average:29.658; most accessible tissue: Zhenshan97 young leaf, score: 47.986 | N | N | N | N |
| vg0623519091 | G -> A | LOC_Os06g39610-LOC_Os06g39624 | intergenic_region ; MODIFIER | silent_mutation | Average:29.658; most accessible tissue: Zhenshan97 young leaf, score: 47.986 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0623519091 | NA | 9.51E-09 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623519091 | NA | 1.08E-06 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623519091 | NA | 2.27E-07 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623519091 | NA | 1.06E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623519091 | NA | 2.39E-07 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623519091 | 1.61E-11 | 5.91E-07 | mr1750_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623519091 | NA | 6.87E-06 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |