Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623456853:

Variant ID: vg0623456853 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 23456853
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


CGGTGGTGGTGGGACAGTGGGGCGACGACGCGGGTGCTTGGGGGAGGATGAGCTCGTGATGTCCATCTTCCCGCTAACATTCTCCACCTACGCGTATGCC[G/A]
TGGGCGCCGAGCTTGCCGCGCTCTTCCCAACAAATCCGGCTACATCATAGCGCCTCGAGCGGAAAGAGGTGGCGGCGGCAGAAGAGGGATTGATCCAACT

Reverse complement sequence

AGTTGGATCAATCCCTCTTCTGCCGCCGCCACCTCTTTCCGCTCGAGGCGCTATGATGTAGCCGGATTTGTTGGGAAGAGCGCGGCAAGCTCGGCGCCCA[C/T]
GGCATACGCGTAGGTGGAGAATGTTAGCGGGAAGATGGACATCACGAGCTCATCCTCCCCCAAGCACCCGCGTCGTCGCCCCACTGTCCCACCACCACCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.40% 36.50% 0.19% 4.91% NA
All Indica  2759 94.10% 3.70% 0.07% 2.10% NA
All Japonica  1512 1.70% 98.10% 0.26% 0.00% NA
Aus  269 33.50% 3.00% 0.37% 63.20% NA
Indica I  595 99.50% 0.30% 0.00% 0.17% NA
Indica II  465 91.60% 6.50% 0.00% 1.94% NA
Indica III  913 93.90% 3.20% 0.11% 2.85% NA
Indica Intermediate  786 91.70% 5.30% 0.13% 2.80% NA
Temperate Japonica  767 1.80% 98.20% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.20% 0.60% 0.00% NA
Japonica Intermediate  241 2.10% 97.50% 0.41% 0.00% NA
VI/Aromatic  96 5.20% 92.70% 0.00% 2.08% NA
Intermediate  90 51.10% 44.40% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0623456853 G -> A LOC_Os06g39510.1 missense_variant ; p.Val90Met; MODERATE nonsynonymous_codon ; V90M Average:82.344; most accessible tissue: Zhenshan97 flower, score: 93.075 unknown unknown TOLERATED 0.16
vg0623456853 G -> DEL LOC_Os06g39510.1 N frameshift_variant Average:82.344; most accessible tissue: Zhenshan97 flower, score: 93.075 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0623456853 G A -0.03 -0.03 -0.03 -0.03 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0623456853 NA 2.36E-10 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623456853 NA 9.49E-06 mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623456853 NA 2.55E-30 mr1256 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623456853 NA 6.47E-07 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623456853 NA 2.41E-29 mr1333 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623456853 NA 2.47E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623456853 NA 3.96E-35 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623456853 NA 7.46E-20 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623456853 NA 5.24E-18 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623456853 NA 2.51E-06 mr1768_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623456853 1.59E-06 NA mr1815_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251