Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623254583:

Variant ID: vg0623254583 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 23254583
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTCTTCAAGACCGCTGCATTACTCGAGCAGCGCGCGAATCGGGACAAGCCGGTTCGTTTCGCCTGGAGACATGATGATGGCGCTCTTCTCGGTTGGCGA[A/G]
CGCAGTTAATGCGCGCACGATCTGCCCCATCTCAACCGTCACGGCCGCACATCTGCCGCGTGCGCCGCAAACGGGCGAGTGGGGTTAGTGGAGGCGTGGG

Reverse complement sequence

CCCACGCCTCCACTAACCCCACTCGCCCGTTTGCGGCGCACGCGGCAGATGTGCGGCCGTGACGGTTGAGATGGGGCAGATCGTGCGCGCATTAACTGCG[T/C]
TCGCCAACCGAGAAGAGCGCCATCATCATGTCTCCAGGCGAAACGAACCGGCTTGTCCCGATTCGCGCGCTGCTCGAGTAATGCAGCGGTCTTGAAGAGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.10%	0.30%	3.00%	39.61%	NA
All Indica	2759	47.20%	0.10%	2.75%	49.98%	NA
All Japonica	1512	72.60%	0.40%	1.79%	25.26%	NA
Aus	269	58.70%	1.10%	13.75%	26.39%	NA
Indica I	595	45.20%	0.00%	2.52%	52.27%	NA
Indica II	465	36.80%	0.00%	2.37%	60.86%	NA
Indica III	913	56.70%	0.20%	3.07%	39.98%	NA
Indica Intermediate	786	43.60%	0.10%	2.80%	53.44%	NA
Temperate Japonica	767	65.70%	0.00%	0.39%	33.90%	NA
Tropical Japonica	504	81.90%	1.00%	3.77%	13.29%	NA
Japonica Intermediate	241	74.70%	0.40%	2.07%	22.82%	NA
VI/Aromatic	96	91.70%	0.00%	0.00%	8.33%	NA
Intermediate	90	62.20%	0.00%	2.22%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0623254583	A -> G	LOC_Os06g39170.1	upstream_gene_variant ; 311.0bp to feature; MODIFIER	silent_mutation	Average:42.39; most accessible tissue: Zhenshan97 flag leaf, score: 77.473	N	N	N	N
vg0623254583	A -> G	LOC_Os06g39160.1	downstream_gene_variant ; 1448.0bp to feature; MODIFIER	silent_mutation	Average:42.39; most accessible tissue: Zhenshan97 flag leaf, score: 77.473	N	N	N	N
vg0623254583	A -> G	LOC_Os06g39180.1	downstream_gene_variant ; 4172.0bp to feature; MODIFIER	silent_mutation	Average:42.39; most accessible tissue: Zhenshan97 flag leaf, score: 77.473	N	N	N	N
vg0623254583	A -> G	LOC_Os06g39160-LOC_Os06g39170	intergenic_region ; MODIFIER	silent_mutation	Average:42.39; most accessible tissue: Zhenshan97 flag leaf, score: 77.473	N	N	N	N
vg0623254583	A -> DEL	N	N	silent_mutation	Average:42.39; most accessible tissue: Zhenshan97 flag leaf, score: 77.473	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0623254583	7.76E-07	2.68E-07	mr1219	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623254583	8.78E-06	1.11E-06	mr1219_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251