Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623014401:

Variant ID: vg0623014401 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 23014401
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.79, A: 0.22, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

AATGGAGAGTCACGCATTAAATCCGAGAAAGCCATTAAGATAATAGGTTGTTTAATTGAAATATGCCTATCGAAAATAAATTTTTCAGATTTAGAAATAT[G/A]
ACTATCAAAAGTAGATGGAGGGAGTATATGAATATATTTGTCTTGAAAAATACTTTCATAAAAGTATACATATATCACTTTTTAATAAATATTTTTATAG

Reverse complement sequence

CTATAAAAATATTTATTAAAAAGTGATATATGTATACTTTTATGAAAGTATTTTTCAAGACAAATATATTCATATACTCCCTCCATCTACTTTTGATAGT[C/T]
ATATTTCTAAATCTGAAAAATTTATTTTCGATAGGCATATTTCAATTAAACAACCTATTATCTTAATGGCTTTCTCGGATTTAATGCGTGACTCTCCATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.80%	25.80%	0.76%	33.64%	NA
All Indica	2759	27.90%	37.10%	0.58%	34.47%	NA
All Japonica	1512	65.30%	1.50%	0.93%	32.28%	NA
Aus	269	8.60%	53.90%	1.49%	36.06%	NA
Indica I	595	3.90%	16.50%	1.18%	78.49%	NA
Indica II	465	25.80%	68.80%	0.65%	4.73%	NA
Indica III	913	44.50%	28.70%	0.22%	26.62%	NA
Indica Intermediate	786	28.00%	43.60%	0.51%	27.86%	NA
Temperate Japonica	767	52.20%	2.10%	1.56%	44.20%	NA
Tropical Japonica	504	83.70%	0.60%	0.40%	15.28%	NA
Japonica Intermediate	241	68.90%	1.20%	0.00%	29.88%	NA
VI/Aromatic	96	55.20%	4.20%	2.08%	38.54%	NA
Intermediate	90	53.30%	27.80%	0.00%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0623014401	G -> A	LOC_Os06g38780.1	upstream_gene_variant ; 3460.0bp to feature; MODIFIER	silent_mutation	Average:34.905; most accessible tissue: Minghui63 root, score: 81.505	N	N	N	N
vg0623014401	G -> A	LOC_Os06g38760.1	downstream_gene_variant ; 2930.0bp to feature; MODIFIER	silent_mutation	Average:34.905; most accessible tissue: Minghui63 root, score: 81.505	N	N	N	N
vg0623014401	G -> A	LOC_Os06g38770.1	downstream_gene_variant ; 1835.0bp to feature; MODIFIER	silent_mutation	Average:34.905; most accessible tissue: Minghui63 root, score: 81.505	N	N	N	N
vg0623014401	G -> A	LOC_Os06g38764.1	intron_variant ; MODIFIER	silent_mutation	Average:34.905; most accessible tissue: Minghui63 root, score: 81.505	N	N	N	N
vg0623014401	G -> DEL	N	N	silent_mutation	Average:34.905; most accessible tissue: Minghui63 root, score: 81.505	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0623014401	NA	8.95E-07	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623014401	NA	1.04E-07	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623014401	NA	3.56E-08	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623014401	NA	1.41E-08	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623014401	NA	1.41E-08	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623014401	NA	8.51E-08	mr1811	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623014401	NA	4.39E-06	mr1812	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623014401	1.92E-06	1.92E-06	mr1427_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251