Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622937195:

Variant ID: vg0622937195 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 22937195
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATATATACTTCGATGGTGTTTCATATTTTTTTTGTTTACGACTCTTGTAATTTGTTGATGTTTCAGTCAATGTATCTGGATGTTTCTTGGGGTTGGATC[G/A]
AAATATTGCACTTGATACTTTGATGGTGTTTCATATTTTTGTTTACGACTCTTGTAATTTGTTGATGTGTTAGCTGTTGAAGCTTGATGTTTCATCTATG

Reverse complement sequence

CATAGATGAAACATCAAGCTTCAACAGCTAACACATCAACAAATTACAAGAGTCGTAAACAAAAATATGAAACACCATCAAAGTATCAAGTGCAATATTT[C/T]
GATCCAACCCCAAGAAACATCCAGATACATTGACTGAAACATCAACAAATTACAAGAGTCGTAAACAAAAAAAATATGAAACACCATCGAAGTATATATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.40%	9.90%	0.66%	53.09%	NA
All Indica	2759	8.00%	6.70%	0.87%	84.41%	NA
All Japonica	1512	79.00%	18.10%	0.33%	2.58%	NA
Aus	269	61.70%	0.00%	0.37%	37.92%	NA
Indica I	595	3.20%	1.00%	0.50%	95.29%	NA
Indica II	465	11.00%	7.70%	0.86%	80.43%	NA
Indica III	913	7.90%	11.60%	0.77%	79.74%	NA
Indica Intermediate	786	9.90%	4.80%	1.27%	83.97%	NA
Temperate Japonica	767	72.10%	26.10%	0.65%	1.17%	NA
Tropical Japonica	504	90.10%	5.00%	0.00%	4.96%	NA
Japonica Intermediate	241	77.60%	20.30%	0.00%	2.07%	NA
VI/Aromatic	96	93.80%	1.00%	0.00%	5.21%	NA
Intermediate	90	55.60%	5.60%	1.11%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0622937195	G -> A	LOC_Os06g38640.1	upstream_gene_variant ; 1795.0bp to feature; MODIFIER	silent_mutation	Average:10.383; most accessible tissue: Callus, score: 57.953	N	N	N	N
vg0622937195	G -> A	LOC_Os06g38620-LOC_Os06g38640	intergenic_region ; MODIFIER	silent_mutation	Average:10.383; most accessible tissue: Callus, score: 57.953	N	N	N	N
vg0622937195	G -> DEL	N	N	silent_mutation	Average:10.383; most accessible tissue: Callus, score: 57.953	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0622937195	4.19E-06	8.85E-06	mr1066	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622937195	1.51E-06	NA	mr1083	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622937195	NA	5.25E-06	mr1438	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251