Variant ID: vg0622686065 (JBrowse) | Variation Type: SNP |
Chromosome: chr06 | Position: 22686065 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAAAAGAAGAATGGCTGGATGAAACGAGTAGTATTAATAATTACTTATATTTTAGGATATAAAATTTAAATCCTTCGATTTATGGATGGAGGTAGTAGAA[G/A]
TAAATAGAAGTACATGAGTATTTGTTTAATTAGATAAAGATGTCATATTATCATATTTTTAATAGAAAATTTCTTATATTAATATATCGTAAAATCTACG
CGTAGATTTTACGATATATTAATATAAGAAATTTTCTATTAAAAATATGATAATATGACATCTTTATCTAATTAAACAAATACTCATGTACTTCTATTTA[C/T]
TTCTACTACCTCCATCCATAAATCGAAGGATTTAAATTTTATATCCTAAAATATAAGTAATTATTAATACTACTCGTTTCATCCAGCCATTCTTCTTTTA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 96.70% | 3.10% | 0.13% | 0.00% | NA |
All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 92.50% | 7.30% | 0.20% | 0.00% | NA |
Aus | 269 | 92.20% | 6.70% | 1.12% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 97.50% | 2.20% | 0.26% | 0.00% | NA |
Tropical Japonica | 504 | 85.50% | 14.30% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 91.30% | 8.70% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0622686065 | G -> A | LOC_Os06g38310-LOC_Os06g38320 | intergenic_region ; MODIFIER | silent_mutation | Average:17.032; most accessible tissue: Zhenshan97 flower, score: 27.882 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0622686065 | NA | 8.79E-06 | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0622686065 | 1.56E-06 | 9.50E-09 | mr1829_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0622686065 | NA | 2.58E-06 | mr1842_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |