Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622642007:

Variant ID: vg0622642007 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 22642007
Reference Allele: CAlternative Allele: G,T
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCAGCCACATGAGCAAAAAGGCTACATGCTCTCGGGGGGTGACAGATCCTTGACCCATGTATGCTGCTACATAGCCAGACCAACCACCTATGTTTTTGGT[C/G,T]
TTGAAATCAAATTTATTCCGGGTGTTCTTGCTCATGGGGTTGGCCGATGAAGTCACATCTAATCCGGTGATCATGGTGATATCGATTAGGGTTGGAGTCA

Reverse complement sequence

TGACTCCAACCCTAATCGATATCACCATGATCACCGGATTAGATGTGACTTCATCGGCCAACCCCATGAGCAAGAACACCCGGAATAAATTTGATTTCAA[G/C,A]
ACCAAAAACATAGGTGGTTGGTCTGGCTATGTAGCAGCATACATGGGTCAAGGATCTGTCACCCCCCGAGAGCATGTAGCCTTTTTGCTCATGTGGCTGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.90% 1.50% 1.99% 4.53% T: 0.06%
All Indica  2759 96.00% 0.00% 0.51% 3.33% T: 0.11%
All Japonica  1512 82.10% 4.80% 5.16% 7.87% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.00% 0.00% 1.01% 2.69% T: 0.34%
Indica II  465 96.30% 0.00% 0.43% 3.23% NA
Indica III  913 95.70% 0.00% 0.22% 4.05% NA
Indica Intermediate  786 96.30% 0.00% 0.51% 3.05% T: 0.13%
Temperate Japonica  767 85.30% 3.50% 5.22% 6.00% NA
Tropical Japonica  504 82.10% 3.00% 3.37% 11.51% NA
Japonica Intermediate  241 72.20% 12.90% 8.71% 6.22% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 0.00% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0622642007 C -> G LOC_Os06g38270.1 missense_variant ; p.Lys34Asn; MODERATE nonsynonymous_codon ; K34N Average:67.712; most accessible tissue: Zhenshan97 flag leaf, score: 88.686 possibly damaging 1.865 DELETERIOUS 0.00
vg0622642007 C -> T LOC_Os06g38270.1 synonymous_variant ; p.Lys34Lys; LOW synonymous_codon Average:67.712; most accessible tissue: Zhenshan97 flag leaf, score: 88.686 N N N N
vg0622642007 C -> DEL LOC_Os06g38270.1 N frameshift_variant Average:67.712; most accessible tissue: Zhenshan97 flag leaf, score: 88.686 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0622642007 C G -0.01 0.0 -0.01 -0.01 -0.01 -0.01
vg0622642007 C T -0.01 0.0 0.0 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0622642007 8.43E-07 8.43E-07 mr1008 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622642007 3.02E-06 3.02E-06 mr1009 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622642007 7.68E-06 7.68E-06 mr1750 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251