Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622522792:

Variant ID: vg0622522792 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 22522792
Reference Allele: A	Alternative Allele: G,C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

CATATATTTGTTGTCATTTGACCGGCCGATCAATATACAAATAACTCCATCCCCCTCAAAAAATATATATATACAAATAACTCTACTTATTTAAAACTAT[A/G,C]
TATACTTGTATACAATATCTCTACTATGGCATTAATATTTAGTTACTTGCCAATATGTAACAACGGATTTGTTCTTGCTTGAGAACACTCCTAGATTAAT

Reverse complement sequence

ATTAATCTAGGAGTGTTCTCAAGCAAGAACAAATCCGTTGTTACATATTGGCAAGTAACTAAATATTAATGCCATAGTAGAGATATTGTATACAAGTATA[T/C,G]
ATAGTTTTAAATAAGTAGAGTTATTTGTATATATATATTTTTTGAGGGGGATGGAGTTATTTGTATATTGATCGGCCGGTCAAATGACAACAAATATATG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.40%	1.30%	1.59%	9.10%	G: 0.66%
All Indica	2759	88.60%	0.00%	0.76%	9.60%	G: 0.98%
All Japonica	1512	83.70%	4.00%	3.24%	8.80%	G: 0.26%
Aus	269	95.90%	0.00%	1.12%	2.97%	NA
Indica I	595	93.60%	0.20%	0.67%	5.55%	NA
Indica II	465	85.40%	0.00%	1.29%	10.32%	G: 3.01%
Indica III	913	85.90%	0.00%	0.77%	12.38%	G: 0.99%
Indica Intermediate	786	89.90%	0.00%	0.51%	9.03%	G: 0.51%
Temperate Japonica	767	75.00%	7.40%	5.48%	11.86%	G: 0.26%
Tropical Japonica	504	96.40%	0.00%	0.00%	3.17%	G: 0.40%
Japonica Intermediate	241	85.10%	1.20%	2.90%	10.79%	NA
VI/Aromatic	96	84.40%	0.00%	0.00%	15.62%	NA
Intermediate	90	87.80%	0.00%	2.22%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0622522792	A -> C	LOC_Os06g38090.1	downstream_gene_variant ; 3895.0bp to feature; MODIFIER	silent_mutation	Average:51.227; most accessible tissue: Callus, score: 73.474	N	N	N	N
vg0622522792	A -> C	LOC_Os06g38080.1	intron_variant ; MODIFIER	silent_mutation	Average:51.227; most accessible tissue: Callus, score: 73.474	N	N	N	N
vg0622522792	A -> G	LOC_Os06g38090.1	downstream_gene_variant ; 3895.0bp to feature; MODIFIER	silent_mutation	Average:51.227; most accessible tissue: Callus, score: 73.474	N	N	N	N
vg0622522792	A -> G	LOC_Os06g38080.1	intron_variant ; MODIFIER	silent_mutation	Average:51.227; most accessible tissue: Callus, score: 73.474	N	N	N	N
vg0622522792	A -> DEL	N	N	silent_mutation	Average:51.227; most accessible tissue: Callus, score: 73.474	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0622522792	NA	1.89E-11	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0622522792	NA	5.45E-06	mr1028	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622522792	NA	4.22E-06	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622522792	NA	9.04E-07	mr1648	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622522792	NA	1.16E-06	mr1652	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622522792	NA	8.40E-06	mr1697	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622522792	NA	7.02E-07	mr1851	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622522792	8.89E-07	8.89E-07	mr1081_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622522792	NA	2.47E-06	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622522792	NA	3.05E-06	mr1788_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251