Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622190408:

Variant ID: vg0622190408 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 22190408
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCATCACGGTGGCAATCACGTGTATCGTATTTTGGAATACAGAGGCTTCTGTATCGCTACTTACGACTCTTACGGGGTCGGTGGTGCCCTATAAGTTGGG[G/A]
AGACCCAGTGTGGCCACACTGCTCCCCCTCCTCCCCTATTATGGACGGCCTTGGACATTGGAATGTGTTTTTTTTAACGACTCGCATCAGACATACAAAG

Reverse complement sequence

CTTTGTATGTCTGATGCGAGTCGTTAAAAAAAACACATTCCAATGTCCAAGGCCGTCCATAATAGGGGAGGAGGGGGAGCAGTGTGGCCACACTGGGTCT[C/T]
CCCAACTTATAGGGCACCACCGACCCCGTAAGAGTCGTAAGTAGCGATACAGAAGCCTCTGTATTCCAAAATACGATACACGTGATTGCCACCGTGATGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.00% 45.90% 0.08% 0.00% NA
All Indica  2759 87.00% 12.90% 0.11% 0.00% NA
All Japonica  1512 5.40% 94.60% 0.00% 0.00% NA
Aus  269 8.60% 91.40% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 84.50% 15.10% 0.43% 0.00% NA
Indica III  913 79.10% 20.80% 0.11% 0.00% NA
Indica Intermediate  786 88.30% 11.70% 0.00% 0.00% NA
Temperate Japonica  767 2.30% 97.70% 0.00% 0.00% NA
Tropical Japonica  504 11.50% 88.50% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 48.90% 50.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0622190408 G -> A LOC_Os06g37500.1 downstream_gene_variant ; 1625.0bp to feature; MODIFIER silent_mutation Average:62.248; most accessible tissue: Zhenshan97 root, score: 85.044 N N N N
vg0622190408 G -> A LOC_Os06g37490-LOC_Os06g37500 intergenic_region ; MODIFIER silent_mutation Average:62.248; most accessible tissue: Zhenshan97 root, score: 85.044 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0622190408 G A -0.06 -0.05 -0.03 -0.07 -0.05 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0622190408 NA 2.26E-06 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622190408 NA 8.37E-14 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622190408 NA 4.71E-65 mr1970 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622190408 NA 8.45E-07 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622190408 NA 3.84E-85 mr1973 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622190408 NA 1.35E-10 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622190408 NA 5.02E-08 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622190408 NA 1.26E-25 mr1323_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622190408 NA 2.67E-19 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622190408 NA 3.27E-07 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622190408 NA 5.01E-11 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622190408 NA 1.95E-14 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622190408 NA 1.83E-67 mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622190408 NA 5.32E-13 mr1970_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622190408 NA 2.57E-99 mr1973_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622190408 NA 1.03E-13 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251