Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621975537:

Variant ID: vg0621975537 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 21975537
Reference Allele: C	Alternative Allele: A,T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTAGTAAGTTGGCAATATTACAAAATTTTGACATGATTTCTTATGCATTTACCAATGTTTGGCAAAAAACTAAATGTATGCATATCTTTGGCAACTTTA[C/A,T]
CAAAAAATGGTATGTACCAAAAAATAATATGATTTGAAATGACATCAATTTAAACAGGCCGTAAAAGTAATTTATTATGTATTTGGAAGAAGAGATAGTA

Reverse complement sequence

TACTATCTCTTCTTCCAAATACATAATAAATTACTTTTACGGCCTGTTTAAATTGATGTCATTTCAAATCATATTATTTTTTGGTACATACCATTTTTTG[G/T,A]
TAAAGTTGCCAAAGATATGCATACATTTAGTTTTTTGCCAAACATTGGTAAATGCATAAGAAATCATGTCAAAATTTTGTAATATTGCCAACTTACTAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.00%	3.60%	4.21%	5.29%	A: 0.87%
All Indica	2759	97.90%	0.00%	0.51%	1.38%	A: 0.22%
All Japonica	1512	79.10%	11.20%	7.41%	0.07%	A: 2.25%
Aus	269	7.40%	0.00%	23.79%	68.77%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	96.60%	0.00%	0.65%	1.51%	A: 1.29%
Indica III	913	97.80%	0.00%	0.44%	1.75%	NA
Indica Intermediate	786	97.10%	0.10%	0.89%	1.91%	NA
Temperate Japonica	767	87.20%	1.60%	11.21%	0.00%	NA
Tropical Japonica	504	63.10%	28.20%	2.58%	0.00%	A: 6.15%
Japonica Intermediate	241	86.70%	6.20%	5.39%	0.41%	A: 1.24%
VI/Aromatic	96	70.80%	0.00%	7.29%	21.88%	NA
Intermediate	90	88.90%	2.20%	2.22%	5.56%	A: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0621975537	C -> T	LOC_Os06g37190.1	upstream_gene_variant ; 577.0bp to feature; MODIFIER	silent_mutation	Average:32.611; most accessible tissue: Callus, score: 74.301	N	N	N	N
vg0621975537	C -> T	LOC_Os06g37200.1	downstream_gene_variant ; 2771.0bp to feature; MODIFIER	silent_mutation	Average:32.611; most accessible tissue: Callus, score: 74.301	N	N	N	N
vg0621975537	C -> T	LOC_Os06g37180-LOC_Os06g37190	intergenic_region ; MODIFIER	silent_mutation	Average:32.611; most accessible tissue: Callus, score: 74.301	N	N	N	N
vg0621975537	C -> A	LOC_Os06g37190.1	upstream_gene_variant ; 577.0bp to feature; MODIFIER	silent_mutation	Average:32.611; most accessible tissue: Callus, score: 74.301	N	N	N	N
vg0621975537	C -> A	LOC_Os06g37200.1	downstream_gene_variant ; 2771.0bp to feature; MODIFIER	silent_mutation	Average:32.611; most accessible tissue: Callus, score: 74.301	N	N	N	N
vg0621975537	C -> A	LOC_Os06g37180-LOC_Os06g37190	intergenic_region ; MODIFIER	silent_mutation	Average:32.611; most accessible tissue: Callus, score: 74.301	N	N	N	N
vg0621975537	C -> DEL	N	N	silent_mutation	Average:32.611; most accessible tissue: Callus, score: 74.301	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0621975537	1.29E-06	1.84E-10	mr1553_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621975537	NA	4.12E-10	mr1817_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251