Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621705466:

Variant ID: vg0621705466 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 21705466
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGTGGATTCGATGTGTATTTGTCCTACGTGGCGTATAAGGTTACTCAAATGAGGTGCTTGCACTGCTACTGCCCTAGAGGGTTCGTTTCCAGATAGAAT[C/T]
AAGACCGATACCCTTCCGGTTTTGTATATAAATATGGCATGGCTGGTAGCTCCATGGATGGAGAAGACGATCTTGAGATTCAATGGAATTTTCCGGTGAA

Reverse complement sequence

TTCACCGGAAAATTCCATTGAATCTCAAGATCGTCTTCTCCATCCATGGAGCTACCAGCCATGCCATATTTATATACAAAACCGGAAGGGTATCGGTCTT[G/A]
ATTCTATCTGGAAACGAACCCTCTAGGGCAGTAGCAGTGCAAGCACCTCATTTGAGTAACCTTATACGCCACGTAGGACAAATACACATCGAATCCACTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.50%	7.50%	0.00%	0.00%	NA
All Indica	2759	94.00%	6.00%	0.00%	0.00%	NA
All Japonica	1512	87.80%	12.20%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	89.60%	10.40%	0.00%	0.00%	NA
Indica Intermediate	786	92.20%	7.80%	0.00%	0.00%	NA
Temperate Japonica	767	83.20%	16.80%	0.00%	0.00%	NA
Tropical Japonica	504	92.10%	7.90%	0.00%	0.00%	NA
Japonica Intermediate	241	93.80%	6.20%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0621705466	C -> T	LOC_Os06g36840.1	upstream_gene_variant ; 2036.0bp to feature; MODIFIER	silent_mutation	Average:64.715; most accessible tissue: Callus, score: 85.473	N	N	N	N
vg0621705466	C -> T	LOC_Os06g36850.1	downstream_gene_variant ; 3485.0bp to feature; MODIFIER	silent_mutation	Average:64.715; most accessible tissue: Callus, score: 85.473	N	N	N	N
vg0621705466	C -> T	LOC_Os06g36840-LOC_Os06g36850	intergenic_region ; MODIFIER	silent_mutation	Average:64.715; most accessible tissue: Callus, score: 85.473	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0621705466	NA	9.23E-07	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621705466	NA	1.10E-06	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621705466	NA	4.46E-09	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621705466	NA	4.29E-06	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621705466	NA	1.41E-06	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621705466	NA	8.53E-06	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621705466	3.08E-06	NA	mr1037_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621705466	6.89E-07	5.33E-07	mr1037_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621705466	NA	1.41E-06	mr1842_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251