Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621192723:

Variant ID: vg0621192723 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 21192723
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


TCCCGCGCCCCCATCCTTCTTGCTGGGCCGGCCCAAGCCGCCTCCCTCCTCTCCCCGGGTCACCGACAGGTGGGGCCCACCTACCGCCGAAACTGCCCAC[G/A]
CCGCCGCGGTTTCCCGCCCTTCTCCGCACCCCCACTCCGCCCCCACCTCGCGCCCACGTCGCTGCCCTCTCCCCTCTCTCTCTCCACCCCCACGTCGCCG

Reverse complement sequence

CGGCGACGTGGGGGTGGAGAGAGAGAGGGGAGAGGGCAGCGACGTGGGCGCGAGGTGGGGGCGGAGTGGGGGTGCGGAGAAGGGCGGGAAACCGCGGCGG[C/T]
GTGGGCAGTTTCGGCGGTAGGTGGGCCCCACCTGTCGGTGACCCGGGGAGAGGAGGGAGGCGGCTTGGGCCGGCCCAGCAAGAAGGATGGGGGCGCGGGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.40% 43.50% 0.11% 0.00% NA
All Indica  2759 92.20% 7.80% 0.00% 0.00% NA
All Japonica  1512 4.60% 95.10% 0.26% 0.00% NA
Aus  269 0.70% 99.30% 0.00% 0.00% NA
Indica I  595 98.20% 1.80% 0.00% 0.00% NA
Indica II  465 92.50% 7.50% 0.00% 0.00% NA
Indica III  913 95.10% 4.90% 0.00% 0.00% NA
Indica Intermediate  786 84.40% 15.60% 0.00% 0.00% NA
Temperate Japonica  767 2.20% 97.70% 0.13% 0.00% NA
Tropical Japonica  504 8.30% 91.70% 0.00% 0.00% NA
Japonica Intermediate  241 4.60% 94.20% 1.24% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 50.00% 48.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0621192723 G -> A LOC_Os06g36190.1 upstream_gene_variant ; 3346.0bp to feature; MODIFIER silent_mutation Average:85.689; most accessible tissue: Zhenshan97 flag leaf, score: 96.984 N N N N
vg0621192723 G -> A LOC_Os06g36180.1 downstream_gene_variant ; 534.0bp to feature; MODIFIER silent_mutation Average:85.689; most accessible tissue: Zhenshan97 flag leaf, score: 96.984 N N N N
vg0621192723 G -> A LOC_Os06g36180-LOC_Os06g36190 intergenic_region ; MODIFIER silent_mutation Average:85.689; most accessible tissue: Zhenshan97 flag leaf, score: 96.984 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0621192723 G A 0.04 0.06 0.02 0.02 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0621192723 NA 1.29E-07 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621192723 NA 1.96E-42 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621192723 NA 5.41E-21 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621192723 NA 1.41E-49 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621192723 NA 3.68E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621192723 NA 8.37E-13 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621192723 NA 4.24E-35 mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621192723 NA 3.60E-11 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621192723 NA 1.41E-26 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621192723 NA 1.53E-07 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621192723 NA 6.89E-48 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621192723 NA 5.03E-32 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621192723 NA 3.61E-29 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621192723 NA 2.49E-08 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621192723 NA 1.87E-12 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621192723 NA 4.18E-30 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621192723 NA 1.64E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621192723 NA 2.21E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621192723 NA 8.98E-30 mr1932_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621192723 NA 5.35E-30 mr1943_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251