Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620778468:

Variant ID: vg0620778468 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 20778468
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.57, G: 0.44, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

GCGGATTCGAGGAGGAATGCTACTTTATTGTCGATTACGAGTCAAACCTTCAGACCACCATGTCGACAACAGTTAGATAGGCTACCCCAAATATTGTACT[G/A]
GTGTGATTATGGTGAATAAGAGCAATACTGGCTTCGGCCAACAGGATGTAGGGCTATTACCTAACAATTCAGAGGCCCAAGCCTGTAAAAAAATCCTCAT

Reverse complement sequence

ATGAGGATTTTTTTACAGGCTTGGGCCTCTGAATTGTTAGGTAATAGCCCTACATCCTGTTGGCCGAAGCCAGTATTGCTCTTATTCACCATAATCACAC[C/T]
AGTACAATATTTGGGGTAGCCTATCTAACTGTTGTCGACATGGTGGTCTGAAGGTTTGACTCGTAATCGACAATAAAGTAGCATTCCTCCTCGAATCCGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.10%	24.60%	0.11%	0.13%	NA
All Indica	2759	72.80%	26.90%	0.14%	0.18%	NA
All Japonica	1512	93.10%	6.80%	0.07%	0.00%	NA
Aus	269	3.00%	97.00%	0.00%	0.00%	NA
Indica I	595	95.60%	4.40%	0.00%	0.00%	NA
Indica II	465	66.70%	32.90%	0.43%	0.00%	NA
Indica III	913	59.00%	40.50%	0.22%	0.22%	NA
Indica Intermediate	786	75.20%	24.40%	0.00%	0.38%	NA
Temperate Japonica	767	93.20%	6.60%	0.13%	0.00%	NA
Tropical Japonica	504	96.20%	3.80%	0.00%	0.00%	NA
Japonica Intermediate	241	86.30%	13.70%	0.00%	0.00%	NA
VI/Aromatic	96	59.40%	40.60%	0.00%	0.00%	NA
Intermediate	90	76.70%	22.20%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0620778468	G -> A	LOC_Os06g35600.1	downstream_gene_variant ; 3428.0bp to feature; MODIFIER	silent_mutation	Average:46.689; most accessible tissue: Zhenshan97 flag leaf, score: 60.705	N	N	N	N
vg0620778468	G -> A	LOC_Os06g35610.1	downstream_gene_variant ; 1309.0bp to feature; MODIFIER	silent_mutation	Average:46.689; most accessible tissue: Zhenshan97 flag leaf, score: 60.705	N	N	N	N
vg0620778468	G -> A	LOC_Os06g35610-LOC_Os06g35620	intergenic_region ; MODIFIER	silent_mutation	Average:46.689; most accessible tissue: Zhenshan97 flag leaf, score: 60.705	N	N	N	N
vg0620778468	G -> DEL	N	N	silent_mutation	Average:46.689; most accessible tissue: Zhenshan97 flag leaf, score: 60.705	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0620778468	NA	6.21E-06	mr1269_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620778468	NA	3.20E-06	mr1291_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620778468	NA	6.41E-06	mr1565_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620778468	NA	4.06E-07	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620778468	NA	1.34E-06	mr1567_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620778468	NA	3.42E-06	mr1677_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620778468	NA	3.67E-06	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620778468	NA	1.31E-06	mr1827_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620778468	1.94E-06	1.94E-06	mr1972_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251