Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620632643:

Variant ID: vg0620632643 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 20632643
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

TTCCCTTTGTAATATGTGGTTTCCATCATATAATCCCATACCAACTAAATTAGCGCTATTACCTACCAAGGGGCCTGAACCAGTATAATCCTTGTCTTTT[G/A]
TTTGCTTGATATCGTACTACGTAGATCCTCGTACCAACATACCCCAATACCCTCTATATCCGGTTTACAGGTATGCCCCGTCAACAGTCGACAGTCTGAG

Reverse complement sequence

CTCAGACTGTCGACTGTTGACGGGGCATACCTGTAAACCGGATATAGAGGGTATTGGGGTATGTTGGTACGAGGATCTACGTAGTACGATATCAAGCAAA[C/T]
AAAAGACAAGGATTATACTGGTTCAGGCCCCTTGGTAGGTAATAGCGCTAATTTAGTTGGTATGGGATTATATGATGGAAACCACATATTACAAAGGGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.40%	17.50%	0.11%	0.00%	NA
All Indica	2759	98.90%	1.00%	0.04%	0.00%	NA
All Japonica	1512	48.30%	51.70%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.40%	2.40%	0.22%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	98.10%	1.90%	0.00%	0.00%	NA
Temperate Japonica	767	75.70%	24.30%	0.00%	0.00%	NA
Tropical Japonica	504	11.90%	87.90%	0.20%	0.00%	NA
Japonica Intermediate	241	36.90%	63.10%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	76.70%	20.00%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0620632643	G -> A	LOC_Os06g35390.1	upstream_gene_variant ; 2976.0bp to feature; MODIFIER	silent_mutation	Average:63.612; most accessible tissue: Zhenshan97 root, score: 84.061	N	N	N	N
vg0620632643	G -> A	LOC_Os06g35400.1	downstream_gene_variant ; 229.0bp to feature; MODIFIER	silent_mutation	Average:63.612; most accessible tissue: Zhenshan97 root, score: 84.061	N	N	N	N
vg0620632643	G -> A	LOC_Os06g35410.1	downstream_gene_variant ; 2704.0bp to feature; MODIFIER	silent_mutation	Average:63.612; most accessible tissue: Zhenshan97 root, score: 84.061	N	N	N	N
vg0620632643	G -> A	LOC_Os06g35400-LOC_Os06g35410	intergenic_region ; MODIFIER	silent_mutation	Average:63.612; most accessible tissue: Zhenshan97 root, score: 84.061	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0620632643	NA	4.18E-06	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620632643	NA	1.12E-12	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620632643	NA	7.61E-07	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620632643	NA	1.46E-19	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620632643	4.47E-07	NA	mr1174_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620632643	5.18E-06	NA	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620632643	NA	1.55E-07	mr1347_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620632643	NA	2.75E-08	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620632643	NA	3.30E-07	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620632643	NA	3.70E-07	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620632643	NA	9.09E-10	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620632643	NA	5.16E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251