Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620431139:

Variant ID: vg0620431139 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 20431139
Reference Allele: TAlternative Allele: C,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


AGCAGCAAATGCTACACTACAACCAAACCAAGTAGTACCAAATTAAACAACATTTGCTCACCTGGTGAGGGGGGAAACGATGAGCTCGACATTGGGGAGG[T/C,G]
AGAGATTTGGACTGAGGGGAAGCATCACCTGTATGTAGAAGAGGAGTTGCCCTGGATTGGGGAGACCGTGCACTGGACGGATGGCCGGTGGTGCCCTGAA

Reverse complement sequence

TTCAGGGCACCACCGGCCATCCGTCCAGTGCACGGTCTCCCCAATCCAGGGCAACTCCTCTTCTACATACAGGTGATGCTTCCCCTCAGTCCAAATCTCT[A/G,C]
CCTCCCCAATGTCGAGCTCATCGTTTCCCCCCTCACCAGGTGAGCAAATGTTGTTTAATTTGGTACTACTTGGTTTGGTTGTAGTGTAGCATTTGCTGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.90% 30.50% 0.47% 1.90% G: 10.18%
All Indica  2759 78.10% 1.20% 0.76% 3.19% G: 16.67%
All Japonica  1512 8.20% 91.00% 0.07% 0.07% G: 0.66%
Aus  269 98.50% 0.00% 0.00% 0.00% G: 1.49%
Indica I  595 95.30% 0.30% 0.00% 0.00% G: 4.37%
Indica II  465 75.70% 2.60% 0.65% 0.22% G: 20.86%
Indica III  913 64.30% 0.40% 1.20% 7.67% G: 26.40%
Indica Intermediate  786 82.70% 2.00% 0.89% 2.16% G: 12.21%
Temperate Japonica  767 6.80% 91.90% 0.00% 0.13% G: 1.17%
Tropical Japonica  504 6.90% 93.10% 0.00% 0.00% NA
Japonica Intermediate  241 15.40% 83.80% 0.41% 0.00% G: 0.41%
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 55.60% 35.60% 0.00% 1.11% G: 7.78%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0620431139 T -> C LOC_Os06g35120.1 upstream_gene_variant ; 1230.0bp to feature; MODIFIER silent_mutation Average:59.651; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg0620431139 T -> C LOC_Os06g35100.1 downstream_gene_variant ; 2978.0bp to feature; MODIFIER silent_mutation Average:59.651; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg0620431139 T -> C LOC_Os06g35110.1 intron_variant ; MODIFIER silent_mutation Average:59.651; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg0620431139 T -> G LOC_Os06g35120.1 upstream_gene_variant ; 1230.0bp to feature; MODIFIER silent_mutation Average:59.651; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg0620431139 T -> G LOC_Os06g35100.1 downstream_gene_variant ; 2978.0bp to feature; MODIFIER silent_mutation Average:59.651; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg0620431139 T -> G LOC_Os06g35110.1 intron_variant ; MODIFIER silent_mutation Average:59.651; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg0620431139 T -> DEL N N silent_mutation Average:59.651; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0620431139 NA 2.66E-23 mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 6.19E-21 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 3.54E-09 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 1.64E-57 mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 5.35E-30 mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 9.86E-90 mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 7.57E-15 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 8.17E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 4.39E-28 mr1223 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 4.72E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 1.68E-16 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 1.68E-10 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 2.76E-13 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 4.03E-35 mr1402 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 3.44E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 1.11E-22 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 1.27E-13 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 1.86E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 4.38E-10 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 1.45E-13 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 1.90E-16 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 4.99E-21 mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 1.61E-08 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 1.06E-24 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 4.03E-06 NA mr1037_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 5.30E-21 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 1.74E-30 mr1102_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 8.61E-07 9.30E-20 mr1165_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 2.43E-07 3.28E-08 mr1165_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 1.79E-20 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 1.47E-35 mr1223_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 1.37E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 5.66E-21 mr1276_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 5.05E-16 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 7.37E-15 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 1.89E-07 7.29E-34 mr1477_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 2.67E-07 2.67E-07 mr1477_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 1.64E-09 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 1.96E-06 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 1.13E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 1.30E-48 mr1546_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 4.94E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 1.18E-09 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 8.44E-09 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 7.23E-06 1.23E-10 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 4.04E-17 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 5.92E-12 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 2.38E-16 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 4.14E-11 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 3.08E-13 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 6.93E-18 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 3.98E-06 mr1827_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 9.36E-23 mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 1.12E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 1.14E-23 mr1971_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 2.10E-06 2.10E-06 mr1971_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620431139 NA 1.19E-10 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251