Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619955116:

Variant ID: vg0619955116 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 19955116
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGAAGCCTTCGGAAGAGTTCGGGTATGGCTCTAGTAACTTTCCTTTCCTCTTTTATAAGCTTTGTACTTTTATTAGAATACTCTTCTAAATACATTTATG[G/C]
TATTGGAATACTTTCTAAGTATATGAGTACCTACTTTACATTATGTTCATGTTATAATGAATATACGGCTAGCTTATCTGGGAGATGTTTTGGTGCGGGT

Reverse complement sequence

ACCCGCACCAAAACATCTCCCAGATAAGCTAGCCGTATATTCATTATAACATGAACATAATGTAAAGTAGGTACTCATATACTTAGAAAGTATTCCAATA[C/G]
CATAAATGTATTTAGAAGAGTATTCTAATAAAAGTACAAAGCTTATAAAAGAGGAAAGGAAAGTTACTAGAGCCATACCCGAACTCTTCCGAAGGCTTCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.70%	0.80%	6.71%	2.77%	NA
All Indica	2759	84.90%	1.30%	10.69%	3.08%	NA
All Japonica	1512	98.00%	0.10%	0.60%	1.32%	NA
Aus	269	94.40%	0.00%	1.86%	3.72%	NA
Indica I	595	76.10%	0.50%	20.34%	3.03%	NA
Indica II	465	78.10%	2.20%	16.13%	3.66%	NA
Indica III	913	93.40%	1.00%	1.97%	3.61%	NA
Indica Intermediate	786	85.80%	1.80%	10.31%	2.16%	NA
Temperate Japonica	767	99.20%	0.00%	0.39%	0.39%	NA
Tropical Japonica	504	95.80%	0.00%	0.99%	3.17%	NA
Japonica Intermediate	241	98.80%	0.40%	0.41%	0.41%	NA
VI/Aromatic	96	85.40%	1.00%	3.12%	10.42%	NA
Intermediate	90	86.70%	1.10%	5.56%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0619955116	G -> C	LOC_Os06g34290.1	upstream_gene_variant ; 688.0bp to feature; MODIFIER	silent_mutation	Average:15.283; most accessible tissue: Zhenshan97 flower, score: 22.37	N	N	N	N
vg0619955116	G -> C	LOC_Os06g34310.1	upstream_gene_variant ; 1800.0bp to feature; MODIFIER	silent_mutation	Average:15.283; most accessible tissue: Zhenshan97 flower, score: 22.37	N	N	N	N
vg0619955116	G -> C	LOC_Os06g34280.1	downstream_gene_variant ; 4350.0bp to feature; MODIFIER	silent_mutation	Average:15.283; most accessible tissue: Zhenshan97 flower, score: 22.37	N	N	N	N
vg0619955116	G -> C	LOC_Os06g34300.1	downstream_gene_variant ; 693.0bp to feature; MODIFIER	silent_mutation	Average:15.283; most accessible tissue: Zhenshan97 flower, score: 22.37	N	N	N	N
vg0619955116	G -> C	LOC_Os06g34320.1	downstream_gene_variant ; 4359.0bp to feature; MODIFIER	silent_mutation	Average:15.283; most accessible tissue: Zhenshan97 flower, score: 22.37	N	N	N	N
vg0619955116	G -> C	LOC_Os06g34290-LOC_Os06g34300	intergenic_region ; MODIFIER	silent_mutation	Average:15.283; most accessible tissue: Zhenshan97 flower, score: 22.37	N	N	N	N
vg0619955116	G -> DEL	N	N	silent_mutation	Average:15.283; most accessible tissue: Zhenshan97 flower, score: 22.37	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0619955116	3.29E-06	6.71E-06	mr1792	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251