Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619806653:

Variant ID: vg0619806653 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 19806653
Reference Allele: A	Alternative Allele: G,C
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, A: 0.29, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

TTCGATGGCACCGTAATACGTGGCAGTTGTTCCATCGTGTCCCATGGCATCGACACGAACAGCGCTGTTTTGGTTCGTGCTCTTCATGTCTTAGGCTCTC[A/G,C]
TGTAGAATGTATACCCATTGATCTCATATCCCTGGAATGTCGCGATCGACCCAGACGGTCCCCTCGCCAGGAAGGCAAGTTGTTGGTTGATCGACTCGTT

Reverse complement sequence

AACGAGTCGATCAACCAACAACTTGCCTTCCTGGCGAGGGGACCGTCTGGGTCGATCGCGACATTCCAGGGATATGAGATCAATGGGTATACATTCTACA[T/C,G]
GAGAGCCTAAGACATGAAGAGCACGAACCAAAACAGCGCTGTTCGTGTCGATGCCATGGGACACGATGGAACAACTGCCACGTATTACGGTGCCATCGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.60%	33.00%	0.42%	0.00%	C: 0.02%
All Indica	2759	95.90%	3.70%	0.33%	0.00%	NA
All Japonica	1512	6.30%	93.50%	0.20%	0.00%	NA
Aus	269	96.70%	1.90%	1.12%	0.00%	C: 0.37%
Indica I	595	97.50%	2.00%	0.50%	0.00%	NA
Indica II	465	95.10%	4.50%	0.43%	0.00%	NA
Indica III	913	97.70%	2.10%	0.22%	0.00%	NA
Indica Intermediate	786	93.30%	6.50%	0.25%	0.00%	NA
Temperate Japonica	767	3.40%	96.50%	0.13%	0.00%	NA
Tropical Japonica	504	11.90%	88.10%	0.00%	0.00%	NA
Japonica Intermediate	241	3.70%	95.40%	0.83%	0.00%	NA
VI/Aromatic	96	97.90%	1.00%	1.04%	0.00%	NA
Intermediate	90	55.60%	40.00%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0619806653	A -> C	LOC_Os06g34000.1	upstream_gene_variant ; 3362.0bp to feature; MODIFIER	silent_mutation	Average:24.711; most accessible tissue: Minghui63 young leaf, score: 43.347	N	N	N	N
vg0619806653	A -> C	LOC_Os06g34010.1	intron_variant ; MODIFIER	silent_mutation	Average:24.711; most accessible tissue: Minghui63 young leaf, score: 43.347	N	N	N	N
vg0619806653	A -> G	LOC_Os06g34000.1	upstream_gene_variant ; 3362.0bp to feature; MODIFIER	silent_mutation	Average:24.711; most accessible tissue: Minghui63 young leaf, score: 43.347	N	N	N	N
vg0619806653	A -> G	LOC_Os06g34010.1	intron_variant ; MODIFIER	silent_mutation	Average:24.711; most accessible tissue: Minghui63 young leaf, score: 43.347	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0619806653	NA	1.02E-06	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619806653	NA	1.43E-07	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619806653	NA	3.61E-14	mr1216_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251