Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619241795:

Variant ID: vg0619241795 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 19241795
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

ACACCAACCTAACCTGACAACGTATGCCGTGTCATATTGTCAGATTCGGCTCAATCGGCTAACCCTGTCCGACTCGAACTCTGCCGATCCTAGTCGCAGC[C/T]
GATTTGGACCTCAGCCGATCCTTACTCTGTTTCTAGGACGATCTCTATCTCGAACTCCGTCTCGACTCCTTTTTCACATCCGATCCTTGGATTACCAAAT

Reverse complement sequence

ATTTGGTAATCCAAGGATCGGATGTGAAAAAGGAGTCGAGACGGAGTTCGAGATAGAGATCGTCCTAGAAACAGAGTAAGGATCGGCTGAGGTCCAAATC[G/A]
GCTGCGACTAGGATCGGCAGAGTTCGAGTCGGACAGGGTTAGCCGATTGAGCCGAATCTGACAATATGACACGGCATACGTTGTCAGGTTAGGTTGGTGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.10%	45.30%	0.15%	6.43%	NA
All Indica	2759	76.20%	23.20%	0.11%	0.58%	NA
All Japonica	1512	2.40%	78.80%	0.20%	18.58%	NA
Aus	269	34.90%	65.10%	0.00%	0.00%	NA
Indica I	595	79.00%	19.20%	0.50%	1.34%	NA
Indica II	465	93.80%	5.80%	0.00%	0.43%	NA
Indica III	913	70.00%	29.80%	0.00%	0.22%	NA
Indica Intermediate	786	70.70%	28.80%	0.00%	0.51%	NA
Temperate Japonica	767	3.40%	68.40%	0.26%	27.90%	NA
Tropical Japonica	504	0.80%	95.80%	0.00%	3.37%	NA
Japonica Intermediate	241	2.90%	75.90%	0.41%	20.75%	NA
VI/Aromatic	96	1.00%	96.90%	1.04%	1.04%	NA
Intermediate	90	43.30%	50.00%	0.00%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0619241795	C -> T	LOC_Os06g33050.1	upstream_gene_variant ; 4895.0bp to feature; MODIFIER	silent_mutation	Average:46.824; most accessible tissue: Zhenshan97 young leaf, score: 67.83	N	N	N	N
vg0619241795	C -> T	LOC_Os06g33040-LOC_Os06g33050	intergenic_region ; MODIFIER	silent_mutation	Average:46.824; most accessible tissue: Zhenshan97 young leaf, score: 67.83	N	N	N	N
vg0619241795	C -> DEL	N	N	silent_mutation	Average:46.824; most accessible tissue: Zhenshan97 young leaf, score: 67.83	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0619241795	NA	5.79E-06	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619241795	NA	2.79E-07	mr1155_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619241795	NA	1.77E-06	mr1167_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619241795	NA	3.58E-06	mr1291_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619241795	NA	8.09E-06	mr1332_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619241795	NA	4.72E-07	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619241795	NA	6.70E-06	mr1428_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619241795	NA	2.80E-06	mr1479_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251