Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618995622:

Variant ID: vg0618995622 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 18995622
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

TGATCTTATAAGATGTGCATGTAATTTGTTTTTTTTATTTTGTAGCAATTGATCGAAGTTGGATGTATGCAAAAAATTTGAAACATCATTCTACGGAGTA[C/T]
AGAAAGGGCGTAATAAATTTTATGAACGTCGCGGAGGAGGATCGGAATAGAAGAAACAATGATTACATGTGTTGTCCATGTGCATATTGCAAGAATGAGA

Reverse complement sequence

TCTCATTCTTGCAATATGCACATGGACAACACATGTAATCATTGTTTCTTCTATTCCGATCCTCCTCCGCGACGTTCATAAAATTTATTACGCCCTTTCT[G/A]
TACTCCGTAGAATGATGTTTCAAATTTTTTGCATACATCCAACTTCGATCAATTGCTACAAAATAAAAAAAACAAATTACATGCACATCTTATAAGATCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.50%	46.40%	0.08%	2.01%	NA
All Indica	2759	80.20%	19.50%	0.04%	0.22%	NA
All Japonica	1512	4.80%	89.60%	0.13%	5.49%	NA
Aus	269	37.20%	62.80%	0.00%	0.00%	NA
Indica I	595	80.00%	19.20%	0.00%	0.84%	NA
Indica II	465	93.30%	6.50%	0.22%	0.00%	NA
Indica III	913	78.30%	21.70%	0.00%	0.00%	NA
Indica Intermediate	786	74.90%	24.90%	0.00%	0.13%	NA
Temperate Japonica	767	3.90%	89.30%	0.00%	6.78%	NA
Tropical Japonica	504	6.90%	91.10%	0.00%	1.98%	NA
Japonica Intermediate	241	3.30%	87.10%	0.83%	8.71%	NA
VI/Aromatic	96	3.10%	92.70%	0.00%	4.17%	NA
Intermediate	90	50.00%	46.70%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0618995622	C -> T	LOC_Os06g32660.1	upstream_gene_variant ; 154.0bp to feature; MODIFIER	silent_mutation	Average:23.344; most accessible tissue: Minghui63 young leaf, score: 47.146	N	N	N	N
vg0618995622	C -> T	LOC_Os06g32650-LOC_Os06g32660	intergenic_region ; MODIFIER	silent_mutation	Average:23.344; most accessible tissue: Minghui63 young leaf, score: 47.146	N	N	N	N
vg0618995622	C -> DEL	N	N	silent_mutation	Average:23.344; most accessible tissue: Minghui63 young leaf, score: 47.146	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0618995622	NA	6.76E-06	mr1371	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618995622	NA	1.95E-08	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618995622	NA	1.37E-07	mr1155_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618995622	NA	3.90E-06	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618995622	4.19E-07	4.19E-07	mr1477_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618995622	NA	2.81E-06	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618995622	NA	2.82E-06	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251