Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618067784:

Variant ID: vg0618067784 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 18067784
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

CAATCACCTGACGAGCAACAAAAACGAAGGGAATAAATGGTTGTGGGTTTTGCCGGGCAGGGCTTCTTCATACCACGGTGGGCTTGAACTCCTTGGCGCA[C/A]
TAGACCTTCTTGAGCTCGGCCTGGAGGCGACCTTGCTCCTCCTCCTTGCGGATGACCTCGTCCCTATTACTGCTCCTCGACGCCGCCCTCTTCGCCTTCT

Reverse complement sequence

AGAAGGCGAAGAGGGCGGCGTCGAGGAGCAGTAATAGGGACGAGGTCATCCGCAAGGAGGAGGAGCAAGGTCGCCTCCAGGCCGAGCTCAAGAAGGTCTA[G/T]
TGCGCCAAGGAGTTCAAGCCCACCGTGGTATGAAGAAGCCCTGCCCGGCAAAACCCACAACCATTTATTCCCTTCGTTTTTGTTGCTCGTCAGGTGATTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.70%	8.60%	4.78%	8.95%	NA
All Indica	2759	78.10%	14.40%	7.03%	0.51%	NA
All Japonica	1512	71.40%	0.30%	1.52%	26.85%	NA
Aus	269	98.10%	0.40%	1.49%	0.00%	NA
Indica I	595	81.80%	4.00%	12.61%	1.51%	NA
Indica II	465	85.60%	9.00%	5.38%	0.00%	NA
Indica III	913	72.70%	25.00%	2.30%	0.00%	NA
Indica Intermediate	786	77.00%	13.10%	9.29%	0.64%	NA
Temperate Japonica	767	61.90%	0.50%	1.17%	36.38%	NA
Tropical Japonica	504	94.40%	0.00%	0.79%	4.76%	NA
Japonica Intermediate	241	53.10%	0.00%	4.15%	42.74%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	87.80%	4.40%	4.44%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0618067784	C -> A	LOC_Os06g31060.2	5_prime_UTR_premature_start_codon_gain_variant ; LOW	silent_mutation	Average:35.052; most accessible tissue: Zhenshan97 flower, score: 49.187	N	N	N	N
vg0618067784	C -> A	LOC_Os06g31060.2	5_prime_UTR_variant ; 1408.0bp to feature; MODIFIER	silent_mutation	Average:35.052; most accessible tissue: Zhenshan97 flower, score: 49.187	N	N	N	N
vg0618067784	C -> A	LOC_Os06g31050.1	upstream_gene_variant ; 3200.0bp to feature; MODIFIER	silent_mutation	Average:35.052; most accessible tissue: Zhenshan97 flower, score: 49.187	N	N	N	N
vg0618067784	C -> A	LOC_Os06g31060.1	upstream_gene_variant ; 1239.0bp to feature; MODIFIER	silent_mutation	Average:35.052; most accessible tissue: Zhenshan97 flower, score: 49.187	N	N	N	N
vg0618067784	C -> A	LOC_Os06g31070.1	downstream_gene_variant ; 4438.0bp to feature; MODIFIER	silent_mutation	Average:35.052; most accessible tissue: Zhenshan97 flower, score: 49.187	N	N	N	N
vg0618067784	C -> DEL	N	N	silent_mutation	Average:35.052; most accessible tissue: Zhenshan97 flower, score: 49.187	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0618067784	NA	2.58E-09	mr1695	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618067784	2.79E-08	NA	mr1087_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618067784	5.48E-07	NA	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618067784	7.56E-09	NA	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618067784	1.64E-07	NA	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618067784	2.03E-08	2.02E-06	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618067784	3.75E-06	NA	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618067784	4.07E-06	NA	mr1526_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618067784	1.94E-08	1.53E-11	mr1695_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251