Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617852939:

Variant ID: vg0617852939 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17852939
Reference Allele: AAlternative Allele: T,G
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGCCTTTTCCTTTGCCTCACTACATCAACTGGTTCGCCGTTGACTAGTGAGTCGGGGGCTACAGATGTTATATCATATTTTTTAAACATTTTTTATAAT[A/T,G]
TTTATCTTGATTGCTTGCGATATAATCTGAGTACAAAAGTGCCTATCGAGTGATGGAGTTTCATCTTCCTATGCTTTCCGTTTGGTTTGCCAATGGATAG

Reverse complement sequence

CTATCCATTGGCAAACCAAACGGAAAGCATAGGAAGATGAAACTCCATCACTCGATAGGCACTTTTGTACTCAGATTATATCGCAAGCAATCAAGATAAA[T/A,C]
ATTATAAAAAATGTTTAAAAAATATGATATAACATCTGTAGCCCCCGACTCACTAGTCAACGGCGAACCAGTTGATGTAGTGAGGCAAAGGAAAAGGCAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.80% 10.20% 0.06% 0.00% NA
All Indica  2759 83.80% 16.10% 0.11% 0.00% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 89.60% 10.40% 0.00% 0.00% NA
Indica I  595 87.60% 12.40% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 79.40% 20.50% 0.11% 0.00% NA
Indica Intermediate  786 77.70% 22.00% 0.25% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617852939 A -> G LOC_Os06g30780-LOC_Os06g30790 intergenic_region ; MODIFIER N Average:34.718; most accessible tissue: Zhenshan97 flower, score: 57.454 N N N N
vg0617852939 A -> T LOC_Os06g30780-LOC_Os06g30790 intergenic_region ; MODIFIER silent_mutation Average:34.718; most accessible tissue: Zhenshan97 flower, score: 57.454 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617852939 NA 6.64E-16 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0617852939 NA 3.43E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852939 NA 3.76E-07 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852939 NA 4.06E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852939 NA 8.34E-08 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852939 NA 5.31E-06 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852939 NA 9.72E-08 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852939 NA 3.11E-07 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852939 NA 5.55E-06 mr1706 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852939 NA 1.29E-07 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852939 NA 1.41E-06 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852939 NA 3.32E-06 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852939 NA 3.29E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852939 NA 1.07E-06 mr1454_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852939 NA 1.79E-06 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852939 NA 8.28E-06 mr1708_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852939 4.54E-06 1.36E-08 mr1860_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852939 NA 4.57E-06 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852939 NA 5.08E-07 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852939 NA 4.46E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852939 NA 3.78E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251