Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617811733:

Variant ID: vg0617811733 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17811733
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGGCCGGTGTCACACACGGTGCGCGTGAGAAAAGGCATGGTGCGGGCCAGCTCAGCTGTGCACGTGGCATGCCACGTCGGCGCGACCGCGGTCAAACGG[C/T]
ATTTTGGACCGGCGATGGTACATTTAGCAAGTTTAGTGGCCTGATTACACGATTTGCAAGTTAATGGACCTGGATAACATCCACCCACAAGTTTAAGGGC

Reverse complement sequence

GCCCTTAAACTTGTGGGTGGATGTTATCCAGGTCCATTAACTTGCAAATCGTGTAATCAGGCCACTAAACTTGCTAAATGTACCATCGCCGGTCCAAAAT[G/A]
CCGTTTGACCGCGGTCGCGCCGACGTGGCATGCCACGTGCACAGCTGAGCTGGCCCGCACCATGCCTTTTCTCACGCGCACCGTGTGTGACACCGGCCAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.60% 35.40% 0.06% 0.00% NA
All Indica  2759 97.20% 2.70% 0.07% 0.00% NA
All Japonica  1512 9.10% 90.90% 0.00% 0.00% NA
Aus  269 65.10% 34.90% 0.00% 0.00% NA
Indica I  595 97.80% 2.20% 0.00% 0.00% NA
Indica II  465 96.30% 3.70% 0.00% 0.00% NA
Indica III  913 98.70% 1.10% 0.22% 0.00% NA
Indica Intermediate  786 95.70% 4.30% 0.00% 0.00% NA
Temperate Japonica  767 3.80% 96.20% 0.00% 0.00% NA
Tropical Japonica  504 18.10% 81.90% 0.00% 0.00% NA
Japonica Intermediate  241 7.50% 92.50% 0.00% 0.00% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 48.90% 50.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617811733 C -> T LOC_Os06g30700.1 upstream_gene_variant ; 309.0bp to feature; MODIFIER silent_mutation Average:82.108; most accessible tissue: Zhenshan97 flag leaf, score: 93.733 N N N N
vg0617811733 C -> T LOC_Os06g30710.1 upstream_gene_variant ; 352.0bp to feature; MODIFIER silent_mutation Average:82.108; most accessible tissue: Zhenshan97 flag leaf, score: 93.733 N N N N
vg0617811733 C -> T LOC_Os06g30710.2 upstream_gene_variant ; 325.0bp to feature; MODIFIER silent_mutation Average:82.108; most accessible tissue: Zhenshan97 flag leaf, score: 93.733 N N N N
vg0617811733 C -> T LOC_Os06g30710.3 upstream_gene_variant ; 325.0bp to feature; MODIFIER silent_mutation Average:82.108; most accessible tissue: Zhenshan97 flag leaf, score: 93.733 N N N N
vg0617811733 C -> T LOC_Os06g30700-LOC_Os06g30710 intergenic_region ; MODIFIER silent_mutation Average:82.108; most accessible tissue: Zhenshan97 flag leaf, score: 93.733 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0617811733 C T 0.02 0.03 0.03 0.02 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617811733 3.50E-11 NA mr1033 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617811733 2.45E-06 3.18E-09 mr1033 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617811733 3.10E-08 NA mr1033 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617811733 NA 1.25E-06 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617811733 NA 3.52E-08 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617811733 NA 7.16E-07 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617811733 NA 5.52E-06 mr1085 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617811733 NA 2.51E-07 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617811733 NA 3.03E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617811733 NA 3.77E-06 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617811733 NA 5.27E-06 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617811733 1.43E-07 3.28E-39 mr1176 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617811733 NA 2.14E-06 mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617811733 2.94E-06 4.70E-08 mr1176 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617811733 NA 4.51E-07 mr1204 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617811733 NA 1.83E-08 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617811733 6.21E-06 1.17E-07 mr1264 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617811733 NA 6.03E-08 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617811733 2.80E-06 2.42E-08 mr1408 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617811733 NA 7.68E-09 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617811733 NA 7.49E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617811733 NA 8.87E-07 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617811733 NA 3.13E-39 mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617811733 4.39E-06 6.16E-08 mr1534 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617811733 1.44E-09 NA mr1033_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251