Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617765147:

Variant ID: vg0617765147 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17765147
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, A: 0.14, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


AATCCAGTACTGAGACACATGACCAGAAGATCCAATAGGCATATATCCATGTGCAAAATCAATTTGAGAATTTTCAGAAAAATTCCTCCGAGGCCGGTCT[G/A]
ACCGAGGGACAGTGGCCGGTCTGACCGGGGACAGGTCTGACCGCCTCTGTACCGCTGGTCTGACCGGGTCGCCGGTCTGACCGGTTTCCTCGAGGGAAAA

Reverse complement sequence

TTTTCCCTCGAGGAAACCGGTCAGACCGGCGACCCGGTCAGACCAGCGGTACAGAGGCGGTCAGACCTGTCCCCGGTCAGACCGGCCACTGTCCCTCGGT[C/T]
AGACCGGCCTCGGAGGAATTTTTCTGAAAATTCTCAAATTGATTTTGCACATGGATATATGCCTATTGGATCTTCTGGTCATGTGTCTCAGTACTGGATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.60% 36.10% 0.28% 0.00% NA
All Indica  2759 96.90% 2.80% 0.25% 0.00% NA
All Japonica  1512 3.40% 96.50% 0.13% 0.00% NA
Aus  269 51.30% 48.70% 0.00% 0.00% NA
Indica I  595 97.50% 2.20% 0.34% 0.00% NA
Indica II  465 96.30% 3.40% 0.22% 0.00% NA
Indica III  913 98.70% 1.10% 0.22% 0.00% NA
Indica Intermediate  786 94.80% 5.00% 0.25% 0.00% NA
Temperate Japonica  767 3.50% 96.50% 0.00% 0.00% NA
Tropical Japonica  504 3.40% 96.40% 0.20% 0.00% NA
Japonica Intermediate  241 2.90% 96.70% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 56.70% 38.90% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617765147 G -> A LOC_Os06g30670.1 intron_variant ; MODIFIER silent_mutation Average:32.433; most accessible tissue: Minghui63 young leaf, score: 48.378 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617765147 NA 8.47E-24 mr1020 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617765147 NA 1.59E-20 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617765147 NA 2.27E-38 mr1064 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617765147 NA 7.79E-57 mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617765147 NA 5.99E-11 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617765147 NA 7.43E-30 mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617765147 NA 1.92E-30 mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617765147 NA 1.97E-39 mr1235 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617765147 NA 7.31E-33 mr1243 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617765147 NA 2.05E-25 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617765147 NA 1.53E-17 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617765147 NA 1.19E-30 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617765147 NA 1.36E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617765147 NA 9.39E-25 mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617765147 NA 4.15E-37 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617765147 NA 4.86E-22 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617765147 NA 2.90E-43 mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617765147 NA 1.35E-08 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617765147 NA 1.37E-22 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617765147 NA 2.70E-16 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617765147 NA 1.37E-22 mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617765147 NA 9.58E-61 mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617765147 NA 9.38E-19 mr1165_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617765147 NA 1.04E-33 mr1477_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617765147 NA 5.71E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617765147 NA 7.03E-23 mr1971_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251