Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617703446:

Variant ID: vg0617703446 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 17703446
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.10, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

CTTTCAGCGCTAAATAGCCTCTTGGGCTAAACCACTACACCAACTAAGCTTGAGTAAAACTCAAACTTAGCAACATGAACTGGCTTTGTCATCGTATCAG[C/T]
AGGATTATCATGACAGTGCTTATATTGTATACCTTTAGCTTACCTTGTGCGACTACATCGTGAATATAATGATACTTGATATCAATGTGATTTGTAACAT

Reverse complement sequence

ATGTTACAAATCACATTGATATCAAGTATCATTATATTCACGATGTAGTCGCACAAGGTAAGCTAAAGGTATACAATATAAGCACTGTCATGATAATCCT[G/A]
CTGATACGATGACAAAGCCAGTTCATGTTGCTAAGTTTGAGTTTTACTCAAGCTTAGTTGGTGTAGTGGTTTAGCCCAAGAGGCTATTTAGCGCTGAAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.80%	49.70%	0.25%	0.23%	NA
All Indica	2759	20.80%	78.50%	0.29%	0.40%	NA
All Japonica	1512	97.60%	2.20%	0.20%	0.00%	NA
Aus	269	58.00%	42.00%	0.00%	0.00%	NA
Indica I	595	19.50%	80.00%	0.17%	0.34%	NA
Indica II	465	5.80%	93.30%	0.43%	0.43%	NA
Indica III	913	22.20%	77.00%	0.44%	0.33%	NA
Indica Intermediate	786	29.00%	70.40%	0.13%	0.51%	NA
Temperate Japonica	767	96.60%	3.40%	0.00%	0.00%	NA
Tropical Japonica	504	98.80%	0.80%	0.40%	0.00%	NA
Japonica Intermediate	241	98.30%	1.20%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	55.60%	43.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0617703446	C -> T	LOC_Os06g30590.1	upstream_gene_variant ; 4135.0bp to feature; MODIFIER	silent_mutation	Average:47.296; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0617703446	C -> T	LOC_Os06g30600.1	upstream_gene_variant ; 1654.0bp to feature; MODIFIER	silent_mutation	Average:47.296; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0617703446	C -> T	LOC_Os06g30610.1	downstream_gene_variant ; 4126.0bp to feature; MODIFIER	silent_mutation	Average:47.296; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0617703446	C -> T	LOC_Os06g30590-LOC_Os06g30600	intergenic_region ; MODIFIER	silent_mutation	Average:47.296; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0617703446	C -> DEL	N	N	silent_mutation	Average:47.296; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0617703446	NA	6.26E-06	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617703446	NA	2.31E-06	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617703446	NA	5.30E-06	mr1134_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617703446	NA	1.69E-09	mr1172_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617703446	NA	5.76E-14	mr1454_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617703446	NA	8.33E-06	mr1462_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251