Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617603352:

Variant ID: vg0617603352 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17603352
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


GTAGCTGTTGGATAGGATAATGGCTCCGCAACGGTATATTGGACGAAACAATGAGCACTTTTGTCAGATCACCGTTTCACTAACATTAGGTCTCCATATC[C/T]
GTTTCCCAGAGCCTCAGCATATCCCATTCCTCCAATTAAACATGGGTGCAGATCCATTAGAACCATCATTTCCCAACCTCTAACCCACAATCCAAATGGC

Reverse complement sequence

GCCATTTGGATTGTGGGTTAGAGGTTGGGAAATGATGGTTCTAATGGATCTGCACCCATGTTTAATTGGAGGAATGGGATATGCTGAGGCTCTGGGAAAC[G/A]
GATATGGAGACCTAATGTTAGTGAAACGGTGATCTGACAAAAGTGCTCATTGTTTCGTCCAATATACCGTTGCGGAGCCATTATCCTATCCAACAGCTAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.40% 4.90% 0.70% 0.00% NA
All Indica  2759 91.10% 7.80% 1.12% 0.00% NA
All Japonica  1512 99.20% 0.70% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.50% 0.00% 1.51% 0.00% NA
Indica II  465 91.20% 7.30% 1.51% 0.00% NA
Indica III  913 86.10% 13.10% 0.77% 0.00% NA
Indica Intermediate  786 91.30% 7.60% 1.02% 0.00% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 5.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617603352 C -> T LOC_Os06g30460.1 intron_variant ; MODIFIER silent_mutation Average:58.891; most accessible tissue: Minghui63 flag leaf, score: 83.826 N N N N
vg0617603352 C -> T LOC_Os06g30460.4 intron_variant ; MODIFIER silent_mutation Average:58.891; most accessible tissue: Minghui63 flag leaf, score: 83.826 N N N N
vg0617603352 C -> T LOC_Os06g30460.5 intron_variant ; MODIFIER silent_mutation Average:58.891; most accessible tissue: Minghui63 flag leaf, score: 83.826 N N N N
vg0617603352 C -> T LOC_Os06g30460.2 intron_variant ; MODIFIER silent_mutation Average:58.891; most accessible tissue: Minghui63 flag leaf, score: 83.826 N N N N
vg0617603352 C -> T LOC_Os06g30460.3 intron_variant ; MODIFIER silent_mutation Average:58.891; most accessible tissue: Minghui63 flag leaf, score: 83.826 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0617603352 C T -0.01 -0.01 0.0 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617603352 7.85E-07 NA mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617603352 7.05E-08 2.11E-12 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617603352 1.12E-06 2.33E-07 mr1111 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617603352 9.56E-07 1.90E-09 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617603352 NA 1.56E-07 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617603352 2.49E-07 NA mr1144 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617603352 9.26E-09 3.26E-13 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617603352 3.31E-06 NA mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617603352 1.44E-09 1.71E-12 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617603352 7.10E-06 NA mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617603352 4.58E-07 1.71E-06 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617603352 2.64E-08 3.80E-11 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617603352 1.47E-07 1.50E-06 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617603352 1.58E-06 NA mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617603352 5.46E-10 1.50E-14 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251