Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617549004:

Variant ID: vg0617549004 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17549004
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, A: 0.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


CGTCCGCTTGCGGATTTTATCTGTAAGGTTAAGAAATACCAACATGTATGGTGACGTGGCTTGGCTATTAGTTGACTGGGATGGGGTTATTGTACATGTC[C/A]
TAAGCCAACTATAAGCACATGTCAAGGAGATATAGATTTATGGTTGTATGTTTGTATGAGATGTGTGACTAGATTTTAATGATAAAGTATATATTTATAT

Reverse complement sequence

ATATAAATATATACTTTATCATTAAAATCTAGTCACACATCTCATACAAACATACAACCATAAATCTATATCTCCTTGACATGTGCTTATAGTTGGCTTA[G/T]
GACATGTACAATAACCCCATCCCAGTCAACTAATAGCCAAGCCACGTCACCATACATGTTGGTATTTCTTAACCTTACAGATAAAATCCGCAAGCGGACG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.90% 33.00% 0.08% 0.00% NA
All Indica  2759 50.40% 49.50% 0.11% 0.00% NA
All Japonica  1512 90.30% 9.70% 0.07% 0.00% NA
Aus  269 94.40% 5.60% 0.00% 0.00% NA
Indica I  595 28.70% 71.10% 0.17% 0.00% NA
Indica II  465 17.00% 82.80% 0.22% 0.00% NA
Indica III  913 80.20% 19.70% 0.11% 0.00% NA
Indica Intermediate  786 52.00% 48.00% 0.00% 0.00% NA
Temperate Japonica  767 98.40% 1.60% 0.00% 0.00% NA
Tropical Japonica  504 76.40% 23.40% 0.20% 0.00% NA
Japonica Intermediate  241 93.40% 6.60% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617549004 C -> A LOC_Os06g30380.1 upstream_gene_variant ; 1085.0bp to feature; MODIFIER silent_mutation Average:39.435; most accessible tissue: Callus, score: 77.96 N N N N
vg0617549004 C -> A LOC_Os06g30370-LOC_Os06g30380 intergenic_region ; MODIFIER silent_mutation Average:39.435; most accessible tissue: Callus, score: 77.96 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617549004 NA 2.88E-41 mr1091 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617549004 NA 2.65E-12 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617549004 NA 9.35E-09 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617549004 NA 2.86E-06 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617549004 NA 1.65E-08 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617549004 NA 6.70E-08 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617549004 NA 2.91E-10 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617549004 NA 1.79E-10 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617549004 NA 2.96E-10 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617549004 NA 1.81E-21 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617549004 NA 1.26E-08 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617549004 NA 6.17E-38 mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617549004 NA 2.77E-11 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617549004 NA 2.87E-16 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617549004 NA 7.38E-07 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617549004 NA 9.54E-06 mr1442_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617549004 NA 5.90E-06 mr1442_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617549004 NA 1.62E-06 mr1469_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617549004 NA 6.56E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617549004 NA 1.69E-11 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617549004 NA 7.80E-07 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617549004 NA 9.88E-13 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617549004 NA 1.28E-08 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617549004 NA 5.24E-26 mr1877_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617549004 NA 2.09E-08 mr1877_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617549004 NA 4.74E-08 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251