Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616884771:

Variant ID: vg0616884771 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 16884771
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:

CACACACACACAAACACTAGCAAAAGTGCTCGTGCGTTGCACCGGGTGATTACGAAGTGTATACAGTGACAAAAAGTGTTATTTGGTTTAGACAATTAAT[T/C]
TGCTCAAAAGAAATTGTTTGTTATTTGTTTTAGACAACTAATCTGCTAAAAAAGATGACGGATGAAAATTTGTATCATGAAGAAAAATATTTATTTTTAT

Reverse complement sequence

ATAAAAATAAATATTTTTCTTCATGATACAAATTTTCATCCGTCATCTTTTTTAGCAGATTAGTTGTCTAAAACAAATAACAAACAATTTCTTTTGAGCA[A/G]
ATTAATTGTCTAAACCAAATAACACTTTTTGTCACTGTATACACTTCGTAATCACCCGGTGCAACGCACGAGCACTTTTGCTAGTGTTTGTGTGTGTGTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	18.40%	0.80%	17.29%	63.44%	NA
All Indica	2759	0.70%	0.50%	3.30%	95.51%	NA
All Japonica	1512	55.40%	1.10%	28.11%	15.41%	NA
Aus	269	0.70%	1.50%	72.49%	25.28%	NA
Indica I	595	2.20%	0.30%	4.03%	93.45%	NA
Indica II	465	0.20%	0.60%	3.01%	96.13%	NA
Indica III	913	0.00%	0.40%	0.77%	98.80%	NA
Indica Intermediate	786	0.50%	0.80%	5.85%	92.88%	NA
Temperate Japonica	767	91.70%	0.30%	3.00%	5.08%	NA
Tropical Japonica	504	7.50%	1.80%	66.67%	24.01%	NA
Japonica Intermediate	241	40.20%	2.10%	27.39%	30.29%	NA
VI/Aromatic	96	1.00%	5.20%	83.33%	10.42%	NA
Intermediate	90	13.30%	0.00%	28.89%	57.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0616884771	T -> C	LOC_Os06g29460.1	upstream_gene_variant ; 3103.0bp to feature; MODIFIER	silent_mutation	Average:26.825; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg0616884771	T -> C	LOC_Os06g29460.2	upstream_gene_variant ; 3103.0bp to feature; MODIFIER	silent_mutation	Average:26.825; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg0616884771	T -> C	LOC_Os06g29460.3	upstream_gene_variant ; 3103.0bp to feature; MODIFIER	silent_mutation	Average:26.825; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg0616884771	T -> C	LOC_Os06g29460-LOC_Os06g29470	intergenic_region ; MODIFIER	silent_mutation	Average:26.825; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg0616884771	T -> DEL	N	N	silent_mutation	Average:26.825; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0616884771	NA	1.66E-06	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616884771	2.83E-06	NA	mr1206_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616884771	NA	6.33E-07	mr1206_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616884771	5.48E-06	2.76E-07	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616884771	NA	2.68E-07	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616884771	NA	3.10E-06	mr1250_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616884771	NA	2.45E-08	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616884771	NA	6.10E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616884771	NA	2.60E-06	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616884771	NA	8.37E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616884771	NA	5.12E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616884771	NA	1.04E-07	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616884771	NA	4.18E-06	mr1763_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616884771	NA	5.55E-08	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616884771	NA	4.96E-07	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251