Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616753926:

Variant ID: vg0616753926 (JBrowse)	Variation Type: INDEL
Chromosome: chr06	Position: 16753926
Reference Allele: T	Alternative Allele: TA,A,TAA
Primary Allele: TA	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCCCGTTACACCATCTACATATATGCGTTCAGCTTTTTTGCTTGCGAAAGTTTTAAGCATTCGCACGATTGAAAACAGATGTAGTGGCTCCCACTACTT[T/TA,A,TAA]
AAAAAACTGTTTTTGCTAGCGTCCAAAATGGGTTTTTCACATATGGTTTATTTGCATGATCTGGTGCGTACGTACAGGATACTATCAAAAGAAAGCATTA

Reverse complement sequence

TAATGCTTTCTTTTGATAGTATCCTGTACGTACGCACCAGATCATGCAAATAAACCATATGTGAAAAACCCATTTTGGACGCTAGCAAAAACAGTTTTTT[A/TA,T,TTA]
AAGTAGTGGGAGCCACTACATCTGTTTTCAATCGTGCGAATGCTTAAAACTTTCGCAAGCAAAAAAGCTGAACGCATATATGTAGATGGTGTAACGGGCA

Allele Frequencies:

Populations	Population Size	Frequency of TA(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.50%	30.90%	0.00%	0.00%	A: 9.54%; TAA: 0.02%
All Indica	2759	96.20%	1.90%	0.00%	0.00%	A: 1.85%; TAA: 0.04%
All Japonica	1512	2.60%	90.80%	0.00%	0.00%	A: 6.55%
Aus	269	24.20%	1.10%	0.00%	0.00%	A: 74.72%
Indica I	595	93.80%	2.70%	0.00%	0.00%	A: 3.53%
Indica II	465	97.20%	1.10%	0.00%	0.00%	A: 1.72%
Indica III	913	99.20%	0.30%	0.00%	0.00%	A: 0.33%; TAA: 0.11%
Indica Intermediate	786	94.00%	3.60%	0.00%	0.00%	A: 2.42%
Temperate Japonica	767	3.50%	96.30%	0.00%	0.00%	A: 0.13%
Tropical Japonica	504	1.60%	81.90%	0.00%	0.00%	A: 16.47%
Japonica Intermediate	241	2.10%	91.70%	0.00%	0.00%	A: 6.22%
VI/Aromatic	96	12.50%	1.00%	0.00%	0.00%	A: 86.46%
Intermediate	90	46.70%	34.40%	0.00%	0.00%	A: 18.89%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0616753926	T -> A	LOC_Os06g29320.1	downstream_gene_variant ; 2860.0bp to feature; MODIFIER	silent_mutation	Average:76.754; most accessible tissue: Callus, score: 94.106	N	N	N	N
vg0616753926	T -> A	LOC_Os06g29330.1	downstream_gene_variant ; 3655.0bp to feature; MODIFIER	silent_mutation	Average:76.754; most accessible tissue: Callus, score: 94.106	N	N	N	N
vg0616753926	T -> A	LOC_Os06g29320-LOC_Os06g29330	intergenic_region ; MODIFIER	silent_mutation	Average:76.754; most accessible tissue: Callus, score: 94.106	N	N	N	N
vg0616753926	T -> TA	LOC_Os06g29320.1	downstream_gene_variant ; 2861.0bp to feature; MODIFIER	silent_mutation	Average:76.754; most accessible tissue: Callus, score: 94.106	N	N	N	N
vg0616753926	T -> TA	LOC_Os06g29330.1	downstream_gene_variant ; 3654.0bp to feature; MODIFIER	silent_mutation	Average:76.754; most accessible tissue: Callus, score: 94.106	N	N	N	N
vg0616753926	T -> TA	LOC_Os06g29320-LOC_Os06g29330	intergenic_region ; MODIFIER	silent_mutation	Average:76.754; most accessible tissue: Callus, score: 94.106	N	N	N	N
vg0616753926	T -> TAA	LOC_Os06g29320.1	downstream_gene_variant ; 2861.0bp to feature; MODIFIER	silent_mutation	Average:76.754; most accessible tissue: Callus, score: 94.106	N	N	N	N
vg0616753926	T -> TAA	LOC_Os06g29330.1	downstream_gene_variant ; 3654.0bp to feature; MODIFIER	silent_mutation	Average:76.754; most accessible tissue: Callus, score: 94.106	N	N	N	N
vg0616753926	T -> TAA	LOC_Os06g29320-LOC_Os06g29330	intergenic_region ; MODIFIER	silent_mutation	Average:76.754; most accessible tissue: Callus, score: 94.106	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0616753926	T	A	-0.01	0.0	-0.01	-0.01	-0.01	-0.02
vg0616753926	T	TA	0.31	0.26	0.11	0.12	0.14	0.1
vg0616753926	T	TAA	0.31	0.3	0.14	0.19	0.2	0.17

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0616753926	NA	3.37E-06	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616753926	NA	1.93E-16	mr1522	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616753926	NA	1.84E-08	mr1126_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616753926	NA	2.52E-11	mr1166_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616753926	NA	5.71E-09	mr1522_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616753926	NA	5.39E-07	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616753926	NA	3.77E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616753926	NA	4.17E-07	mr1762_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251