Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616709270:

Variant ID: vg0616709270 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 16709270
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCAAATCATGAAAGATCAAATTCATTGCCCTTTGATATGTTGCACCGGCATTCTTCAACCCAAAAGTCATGACAACTCACTCAAACAAACCAACAAATCC[C/T]
GGGCATCTAAAAGCCGTCTTGTACATATCCTCTTCCGCCATAAAGATTTGATTGTAGCCGGCATTACCATCTAGAAAGCTAATCACCTTATGACCCGAGG

Reverse complement sequence

CCTCGGGTCATAAGGTGATTAGCTTTCTAGATGGTAATGCCGGCTACAATCAAATCTTTATGGCGGAAGAGGATATGTACAAGACGGCTTTTAGATGCCC[G/A]
GGATTTGTTGGTTTGTTTGAGTGAGTTGTCATGACTTTTGGGTTGAAGAATGCCGGTGCAACATATCAAAGGGCAATGAATTTGATCTTTCATGATTTGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.80%	0.30%	1.82%	6.09%	NA
All Indica	2759	86.40%	0.50%	2.94%	10.15%	NA
All Japonica	1512	99.70%	0.00%	0.13%	0.20%	NA
Aus	269	98.90%	0.00%	0.37%	0.74%	NA
Indica I	595	73.80%	0.70%	5.88%	19.66%	NA
Indica II	465	78.10%	0.60%	4.30%	16.99%	NA
Indica III	913	98.80%	0.30%	0.33%	0.55%	NA
Indica Intermediate	786	86.60%	0.40%	2.93%	10.05%	NA
Temperate Japonica	767	99.60%	0.00%	0.26%	0.13%	NA
Tropical Japonica	504	99.80%	0.00%	0.00%	0.20%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	0.00%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0616709270	C -> T	LOC_Os06g29270.1	synonymous_variant ; p.Pro570Pro; LOW	synonymous_codon	Average:26.347; most accessible tissue: Minghui63 young leaf, score: 51.901	N	N	N	N
vg0616709270	C -> DEL	LOC_Os06g29270.1	N	frameshift_variant	Average:26.347; most accessible tissue: Minghui63 young leaf, score: 51.901	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0616709270	NA	2.18E-09	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616709270	NA	7.41E-07	mr1242_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616709270	NA	2.80E-07	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616709270	NA	7.73E-07	mr1548_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616709270	6.69E-07	6.69E-07	mr1666_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616709270	NA	1.97E-06	mr1761_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616709270	NA	5.25E-08	mr1834_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616709270	NA	3.41E-12	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616709270	NA	4.03E-08	mr1850_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251