Search for Variation information by Variation ID:
Detailed information for vg0616628202:
| Variant ID: vg0616628202 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 16628202 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.01, others allele: 0.00, population size: 72. )
Flanking Sequence (100 bp) in Reference Genome:
GTCGTCAGGGGCCTTAGGCCACCGTTCGGCTCGGGGGCCTCTCCTCCCTGCTCGCTCCCGGGCCAAGTCAGCACAGGGTGAGGGTGCGCGGAATGAGGAT[C/T]
GTCCTCATCGCGCTCCACAACCAACGCTGCACTAACTACTTGGGGGGTCGCCGCTAAGTAGAGCAGCAGGGGCTCATTTGGCTCCGGGGCGACTAAAACC
Reverse complement sequence
GGTTTTAGTCGCCCCGGAGCCAAATGAGCCCCTGCTGCTCTACTTAGCGGCGACCCCCCAAGTAGTTAGTGCAGCGTTGGTTGTGGAGCGCGATGAGGAC[G/A]
ATCCTCATTCCGCGCACCCTCACCCTGTGCTGACTTGGCCCGGGAGCGAGCAGGGAGGAGAGGCCCCCGAGCCGAACGGTGGCCTAAGGCCCCTGACGAC
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.30% | 0.30% | 4.32% | 33.05% | NA |
| All Indica | 2759 | 44.10% | 0.50% | 6.49% | 48.86% | NA |
| All Japonica | 1512 | 99.10% | 0.00% | 0.13% | 0.73% | NA |
| Aus | 269 | 45.40% | 0.00% | 1.86% | 52.79% | NA |
| Indica I | 595 | 39.50% | 0.20% | 6.39% | 53.95% | NA |
| Indica II | 465 | 41.90% | 1.10% | 8.17% | 48.82% | NA |
| Indica III | 913 | 45.60% | 0.20% | 5.59% | 48.63% | NA |
| Indica Intermediate | 786 | 47.30% | 0.80% | 6.62% | 45.29% | NA |
| Temperate Japonica | 767 | 98.70% | 0.00% | 0.00% | 1.30% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.83% | 0.41% | NA |
| VI/Aromatic | 96 | 40.60% | 0.00% | 14.58% | 44.79% | NA |
| Intermediate | 90 | 75.60% | 0.00% | 4.44% | 20.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0616628202 | C -> T | LOC_Os06g29140.1 | missense_variant ; p.Asp1039Asn; MODERATE | nonsynonymous_codon ; D1039N | Average:13.767; most accessible tissue: Callus, score: 25.164 | benign  |
-1.29 |
TOLERATED | 1.00 |
| vg0616628202 | C -> DEL | LOC_Os06g29140.1 | N | frameshift_variant | Average:13.767; most accessible tissue: Callus, score: 25.164 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0616628202 | 2.21E-06 | NA | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616628202 | 2.02E-07 | NA | mr1091 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616628202 | 3.36E-07 | NA | mr1091 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616628202 | 5.68E-06 | NA | mr1094 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616628202 | 8.78E-06 | NA | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616628202 | 3.36E-06 | NA | mr1112 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0616628202 | NA | 3.37E-07 | mr1717 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |