Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0616229238:

Variant ID: vg0616229238 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 16229238
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.04, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

CACTAGTACAAGAAAGAAACTTTACATAACCAATCATACCAAATTTGGATTCCTTCCAAATTCAACTCCGCATCCCATACGCACACAATAACTCCATCGT[T/A]
TGCCATATGGAATCTCCATCAACCACGTGCATCAACTCTAGCCTAAGTATCCCGCATGATCTCTGACCACAACGGACGTCGTCTTATCCCCAAGACGACT

Reverse complement sequence

AGTCGTCTTGGGGATAAGACGACGTCCGTTGTGGTCAGAGATCATGCGGGATACTTAGGCTAGAGTTGATGCACGTGGTTGATGGAGATTCCATATGGCA[A/T]
ACGATGGAGTTATTGTGTGCGTATGGGATGCGGAGTTGAATTTGGAAGGAATCCAAATTTGGTATGATTGGTTATGTAAAGTTTCTTTCTTGTACTAGTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.90%	31.70%	10.71%	11.72%	NA
All Indica	2759	61.20%	2.80%	16.96%	19.06%	NA
All Japonica	1512	6.90%	91.30%	1.39%	0.40%	NA
Aus	269	88.10%	1.50%	2.97%	7.43%	NA
Indica I	595	86.20%	3.00%	3.53%	7.23%	NA
Indica II	465	77.80%	1.50%	12.04%	8.60%	NA
Indica III	913	34.70%	1.20%	31.00%	33.08%	NA
Indica Intermediate	786	63.20%	5.10%	13.74%	17.94%	NA
Temperate Japonica	767	2.30%	96.30%	0.65%	0.65%	NA
Tropical Japonica	504	13.50%	83.50%	2.78%	0.20%	NA
Japonica Intermediate	241	7.50%	91.70%	0.83%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	50.00%	37.80%	10.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0616229238	T -> A	LOC_Os06g28524.1	downstream_gene_variant ; 3928.0bp to feature; MODIFIER	silent_mutation	Average:16.36; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0616229238	T -> A	LOC_Os06g28524-LOC_Os06g28530	intergenic_region ; MODIFIER	silent_mutation	Average:16.36; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0616229238	T -> DEL	N	N	silent_mutation	Average:16.36; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0616229238	NA	2.55E-07	mr1020	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616229238	NA	3.85E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616229238	7.04E-06	4.31E-08	mr1176	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616229238	NA	9.05E-09	mr1971	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616229238	4.10E-07	4.10E-07	mr1477_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616229238	NA	3.66E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616229238	NA	1.48E-16	mr1730_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616229238	6.94E-06	6.94E-06	mr1971_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251