RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0616129303:

Variant ID: vg0616129303 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 16129303
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:

CGAGGACAAGACTGACGAGGATTATGATCAGTTTGATGGACAACCCATTTCACGGTGACGGTTGACCCTAGCATCCTCCTATCAAACGAAGACACCCCTT[G/A]
CTCACGCAGCGATCACAAGGAAGGAATAGTAGTGTGGAGAAAATACGTGCGGTCAACCGTCACCGCCGATGTATTGCTGTAATTGTTGTGTACACGATGT

Reverse complement sequence

ACATCGTGTACACAACAATTACAGCAATACATCGGCGGTGACGGTTGACCGCACGTATTTTCTCCACACTACTATTCCTTCCTTGTGATCGCTGCGTGAG[C/T]
AAGGGGTGTCTTCGTTTGATAGGAGGATGCTAGGGTCAACCGTCACCGTGAAATGGGTTGTCCATCAAACTGATCATAATCCTCGTCAGTCTTGTCCTCG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.90%	31.00%	0.02%	0.00%	NA
All Indica	2759	97.90%	2.10%	0.04%	0.00%	NA
All Japonica	1512	9.10%	90.90%	0.00%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	97.30%	2.50%	0.17%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	95.90%	4.10%	0.00%	0.00%	NA
Temperate Japonica	767	3.70%	96.30%	0.00%	0.00%	NA
Tropical Japonica	504	17.90%	82.10%	0.00%	0.00%	NA
Japonica Intermediate	241	8.30%	91.70%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	65.60%	34.40%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0616129303	G -> A	LOC_Os06g28360.1	upstream_gene_variant ; 1735.0bp to feature; MODIFIER	silent_mutation	Average:48.085; most accessible tissue: Zhenshan97 flag leaf, score: 74.498	N	N	N	N
vg0616129303	G -> A	LOC_Os06g28370.1	upstream_gene_variant ; 4353.0bp to feature; MODIFIER	silent_mutation	Average:48.085; most accessible tissue: Zhenshan97 flag leaf, score: 74.498	N	N	N	N
vg0616129303	G -> A	LOC_Os06g28350.1	downstream_gene_variant ; 43.0bp to feature; MODIFIER	silent_mutation	Average:48.085; most accessible tissue: Zhenshan97 flag leaf, score: 74.498	N	N	N	N
vg0616129303	G -> A	LOC_Os06g28350-LOC_Os06g28360	intergenic_region ; MODIFIER	silent_mutation	Average:48.085; most accessible tissue: Zhenshan97 flag leaf, score: 74.498	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0616129303	9.79E-06	3.02E-73	mr1018	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616129303	NA	5.14E-58	mr1019	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616129303	NA	2.01E-06	mr1020	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616129303	NA	3.60E-19	mr1021	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616129303	4.02E-10	9.60E-76	mr1033	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616129303	2.67E-07	1.25E-12	mr1033	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616129303	3.89E-07	3.89E-07	mr1065	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616129303	1.95E-08	1.95E-08	mr1067	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616129303	2.62E-09	2.62E-09	mr1068	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0616129303	NA	9.24E-89	mr1071	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 72 entries

Previous1 2 3 4 5…8Next

Search for Variation information by Variation ID:

Detailed information for vg0616129303:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact