| Variant ID: vg0614629276 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 14629276 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.79, G: 0.21, others allele: 0.00, population size: 34. )
ATAATATTGTACGATTTAATTTAGTCTATGATTAAACGATTAAATATAACACACGGCTAAAATCCGTAGTAATTAAATCCGAATTTCTACCGTGAATCGA[T/G]
TACTTATAGAGATTACCCAAAAATAATCTATAAGAATTCATCTATTTGTTTAGTTATTAATTACATCTAAATTACTACCGCGAATTGATTTATTATAGAA
TTCTATAATAAATCAATTCGCGGTAGTAATTTAGATGTAATTAATAACTAAACAAATAGATGAATTCTTATAGATTATTTTTGGGTAATCTCTATAAGTA[A/C]
TCGATTCACGGTAGAAATTCGGATTTAATTACTACGGATTTTAGCCGTGTGTTATATTTAATCGTTTAATCATAGACTAAATTAAATCGTACAATATTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.30% | 32.30% | 10.96% | 19.40% | NA |
| All Indica | 2759 | 54.20% | 4.10% | 12.69% | 29.00% | NA |
| All Japonica | 1512 | 7.10% | 91.00% | 0.66% | 1.19% | NA |
| Aus | 269 | 24.20% | 1.10% | 51.67% | 23.05% | NA |
| Indica I | 595 | 32.60% | 8.10% | 13.61% | 45.71% | NA |
| Indica II | 465 | 40.00% | 3.00% | 14.41% | 42.58% | NA |
| Indica III | 913 | 82.80% | 0.70% | 6.57% | 9.97% | NA |
| Indica Intermediate | 786 | 45.70% | 5.90% | 18.07% | 30.41% | NA |
| Temperate Japonica | 767 | 1.40% | 96.30% | 0.52% | 1.69% | NA |
| Tropical Japonica | 504 | 16.30% | 82.30% | 0.99% | 0.40% | NA |
| Japonica Intermediate | 241 | 6.20% | 92.10% | 0.41% | 1.24% | NA |
| VI/Aromatic | 96 | 66.70% | 3.10% | 6.25% | 23.96% | NA |
| Intermediate | 90 | 34.40% | 35.60% | 14.44% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0614629276 | T -> G | LOC_Os06g24960.1 | upstream_gene_variant ; 3826.0bp to feature; MODIFIER | silent_mutation | Average:8.662; most accessible tissue: Zhenshan97 panicle, score: 16.188 | N | N | N | N |
| vg0614629276 | T -> G | LOC_Os06g24970.1 | upstream_gene_variant ; 2283.0bp to feature; MODIFIER | silent_mutation | Average:8.662; most accessible tissue: Zhenshan97 panicle, score: 16.188 | N | N | N | N |
| vg0614629276 | T -> G | LOC_Os06g24970-LOC_Os06g24990 | intergenic_region ; MODIFIER | silent_mutation | Average:8.662; most accessible tissue: Zhenshan97 panicle, score: 16.188 | N | N | N | N |
| vg0614629276 | T -> DEL | N | N | silent_mutation | Average:8.662; most accessible tissue: Zhenshan97 panicle, score: 16.188 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0614629276 | NA | 2.80E-06 | mr1020 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614629276 | 3.22E-07 | 3.22E-07 | mr1032 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614629276 | 3.45E-06 | NA | mr1043 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614629276 | 5.33E-06 | NA | mr1535 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614629276 | NA | 1.28E-07 | mr1971 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |