Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0614459942:

Variant ID: vg0614459942 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 14459942
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTAGTTTTAATAGTCAGCTCTCTCTGTTTGCTGGTTCTGTGTGGGATTTTCAGATGGTGACAACCAGGAGAAGCGCTGTTACTGGCGAAGGCAGTCATCC[C/T]
GAAGGCAGCAACCCCAACAACCATGACAGCCCACCTCCACCTCCTCCCCACCACCACCACCGCCACCTGACACCAACCCCATCCTCACCCAAATCCTCGC

Reverse complement sequence

GCGAGGATTTGGGTGAGGATGGGGTTGGTGTCAGGTGGCGGTGGTGGTGGTGGGGAGGAGGTGGAGGTGGGCTGTCATGGTTGTTGGGGTTGCTGCCTTC[G/A]
GGATGACTGCCTTCGCCAGTAACAGCGCTTCTCCTGGTTGTCACCATCTGAAAATCCCACACAGAACCAGCAAACAGAGAGAGCTGACTATTAAAACTAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.20%	24.50%	6.33%	11.02%	NA
All Indica	2759	35.40%	39.80%	10.00%	14.75%	NA
All Japonica	1512	92.40%	0.30%	0.66%	6.61%	NA
Aus	269	84.00%	11.50%	2.60%	1.86%	NA
Indica I	595	34.30%	18.20%	18.15%	29.41%	NA
Indica II	465	24.10%	49.50%	12.90%	13.55%	NA
Indica III	913	37.80%	49.90%	4.49%	7.78%	NA
Indica Intermediate	786	40.20%	38.80%	8.52%	12.47%	NA
Temperate Japonica	767	97.10%	0.10%	0.39%	2.35%	NA
Tropical Japonica	504	84.70%	0.80%	0.99%	13.49%	NA
Japonica Intermediate	241	93.40%	0.00%	0.83%	5.81%	NA
VI/Aromatic	96	95.80%	1.00%	2.08%	1.04%	NA
Intermediate	90	64.40%	22.20%	4.44%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0614459942	C -> T	LOC_Os06g24630.1	upstream_gene_variant ; 465.0bp to feature; MODIFIER	silent_mutation	Average:26.834; most accessible tissue: Callus, score: 46.604	N	N	N	N
vg0614459942	C -> T	LOC_Os06g24620.1	downstream_gene_variant ; 296.0bp to feature; MODIFIER	silent_mutation	Average:26.834; most accessible tissue: Callus, score: 46.604	N	N	N	N
vg0614459942	C -> T	LOC_Os06g24620-LOC_Os06g24630	intergenic_region ; MODIFIER	silent_mutation	Average:26.834; most accessible tissue: Callus, score: 46.604	N	N	N	N
vg0614459942	C -> DEL	N	N	silent_mutation	Average:26.834; most accessible tissue: Callus, score: 46.604	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0614459942	NA	3.67E-06	mr1252	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614459942	NA	6.75E-06	mr1403	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614459942	NA	1.17E-08	mr1830	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614459942	NA	1.94E-11	mr1846	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614459942	NA	2.97E-11	mr1846	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614459942	NA	3.34E-07	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614459942	NA	1.44E-07	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614459942	NA	4.76E-16	mr1830_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614459942	NA	7.58E-12	mr1830_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614459942	3.06E-07	1.31E-22	mr1846_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614459942	4.43E-07	2.18E-23	mr1846_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251