Search for Variation information by Variation ID:
Detailed information for vg0613452181:
| Variant ID: vg0613452181 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 13452181 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 222. )
Flanking Sequence (100 bp) in Reference Genome:
GCAGAAAGATGATTTGATCACGGACCTAGAAGAAACCTTTGCGAGCATCCGCGCTTTCAGATGAAATTAAACCATGAAAAGTGCATCTTCGGAGTACCGT[T/C]
AGGGAAGCTGCTTGGATTTATGGTGTCTCATAGAGGCATACAAGCCAACCCGGAGAAAATCAATGCCATCCTCAACATGAAACCGCCATGTTCTCAGAAA
Reverse complement sequence
TTTCTGAGAACATGGCGGTTTCATGTTGAGGATGGCATTGATTTTCTCCGGGTTGGCTTGTATGCCTCTATGAGACACCATAAATCCAAGCAGCTTCCCT[A/G]
ACGGTACTCCGAAGATGCACTTTTCATGGTTTAATTTCATCTGAAAGCGCGGATGCTCGCAAAGGTTTCTTCTAGGTCCGTGATCAAATCATCTTTCTGC
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.10% | 30.10% | 0.21% | 0.57% | NA |
| All Indica | 2759 | 97.40% | 2.50% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 10.40% | 87.60% | 0.33% | 1.72% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.30% | 2.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.50% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 3.80% | 94.10% | 0.00% | 2.09% | NA |
| Tropical Japonica | 504 | 21.40% | 77.40% | 0.40% | 0.79% | NA |
| Japonica Intermediate | 241 | 8.30% | 88.00% | 1.24% | 2.49% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 31.10% | 2.22% | 1.11% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0613452181 | T -> C | LOC_Os06g23070.1 | missense_variant ; p.Leu749Ser; MODERATE | nonsynonymous_codon ; L749S | Average:38.373; most accessible tissue: Minghui63 flag leaf, score: 62.47 | benign  |
-0.609 |
TOLERATED | 1.00 |
| vg0613452181 | T -> DEL | LOC_Os06g23070.1 | N | frameshift_variant | Average:38.373; most accessible tissue: Minghui63 flag leaf, score: 62.47 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0613452181 | 3.36E-21 | 1.86E-89 | mr1033 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452181 | 9.17E-13 | 4.75E-19 | mr1033 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452181 | 5.30E-13 | 1.26E-47 | mr1176 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452181 | 5.60E-09 | 1.94E-12 | mr1176 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452181 | NA | 5.33E-15 | mr1276 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452181 | NA | 3.66E-20 | mr1477 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452181 | 1.86E-07 | NA | mr1536 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452181 | 4.49E-30 | 4.72E-126 | mr1033_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452181 | 4.30E-17 | 4.03E-28 | mr1033_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452181 | 9.47E-12 | 4.65E-95 | mr1536_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452181 | 6.42E-09 | 1.02E-11 | mr1536_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |